Mmlv reverse transcriptase

Cells were lysed with 4 M guanidinthiocyanat (Roth, Karlsruhe, Germany) and total RNA was extracted using the acid guanidinium thiocyanate/phenol/chloroform extraction method [45 (link)]. A total of 1 μg of RNA was reverse-transcribed into cDNA by the use of 200 U of Moloney murine leukemia virus (MMLV) reverse transcriptase (Bio-Rad, Munich, Germany). cDNA expression was detected by real-time PCR (RT-PCR) using specific primers (18S: fwd: CGGCTACCACATCCAAGGAA, rev: GCTGGAATTACCGCGGCT and NOX4: fwd: TCTGCCTGTTCATCTGGCTCTCCA, rev: AGCCAAGAGTGTTCGGCACATGGGTA) and SYBR Green as fluorescent dye on the ViiA7 detection system (Applied Biosystems, Darmstadt, Germany). Two μL of cDNA served as template in a 20 μL reaction mixture containing 10 μL QuantiTect SYBR Green Master Mix (Qiagen, Hilden, Germany). The mixture was heated initially to 50°C for 2 min and to 95°C for 15 min followed by 40 cycles with denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Amounts of specific cDNA were normalized to the housekeeping gene 18S and cDNA expression was calculated as relative expression of the respective control.

RNA was extracted with TRIzol reagent (Life Technologies; Carlsbad, CA) following standard RNA extraction procedures. Total RNA (1μg) was reverse transcribed using MMLV reverse transcriptase (Bio-Rad; Hercules, CA) and the resulting cDNA was used for qPCR reactions with All-in-One qPCR Mix (GeneCopoeia). The triplicate samples were amplified in 20 μL reactions with gene-specific primers. The relative fold change of mRNA expression was determined for each group using the 2^-ΔΔCt method with GAPDH expression as an internal control.

The hippocampi of rats (n = 4 per group from the first experiment) were homogenized and RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The quality and quantity of the extracted RNA in each tissue was examined with spectrophotometry (Beckman DU7500). Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV reverse transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA). Each reaction was then incubated at 37°C for 1 h. Equal amounts of cDNA (2 μl) were then used for subsequent PCR using iTap SYBR Green Master Mix (Bio-Rad, CA, USA). The 2^−ΔΔCt method [ΔCT = (Ct_target − Ct_GAPDH)] was then used to convert 1CT values to mRNA fold changes relative to the control group. The mRNA levels of the targets were normalized with glyceraldehyde-3-phosphatedehydrogenase (GAPDH) mRNA level to exclude effects of varying RNA amounts.
Please see Supplementary Table S2 for oligonucleotide primers specific for rat.

RNA was extracted with TRIzol reagent (Life Technologies; Carlsbad, CA) following standard RNA extraction protocol. One μg of total RNA was reverse transcribed using MMLV reverse transcriptase (Bio-Rad; Hercules, CA) and the resulting cDNA was used for qRT-PCR reactions with SYBR Green qPCR Mastermix (Qiagen; Valencia, CA). The samples were amplified in 25 μL reactions with gene specific primers. The primers used for amplification were as follows: GAPDH Forward: 3′-TGC ACC ACC AAC TGC TTA GC-5′, Reverse: 3′-GGC ATG GAC TGT GGT CAT GAG-5′; and CIP2A Forward: 3′-GAA CAG ATA AGA AAA GAG TTG AGC ATT-5′, Reverse: 3′-CGA CCT TCT AAT TGT GCC TTT T-5′. Each reaction mixture was amplified in triplicate and the results calculated based on the ΔΔCt method. The cycle threshold (Ct) value for CIP2A gene expression was normalized using the mean Ct value for GAPDH gene expression. Relative gene expression was expressed as the fold change (2^–ΔΔCt) relative to expression in the untreated control.

Total RNA from intestinal tissue and organoids at day 4 of culture was purified using the Monarch total RNA extraction kit, according to the manufacturer's protocol (New England Biolabs, USA). Concentration of RNA in samples was determined using a spectrophotometer DS-11Fx (DeNovix, USA). For reverse transcription, 0.5 μg of total RNA was transcribed using the M-MLV Reverse Transcriptase, according to the protocol (Bio-Rad: Cat.# 1708841). Quantitative RT–PCR was performed on a thermocycler QuantStudioTM 3 (Thermofisher Scientific, USA), using FastStart Universal SYBR Green master (Roche), 200 nM of each specific primer (excepting primers for Chromogranin A, which were used at 60 nM), and 1μL of cDNA. The following cycling parameters were used for all the markers: 1 cycle of 95 °C for 4 min; 40 cycles of 95 °C for 10 s, 60 °C for 20 s and 72 °C for 30 s; 1 cycle of 72 °C for 5 min; melting curve analysis over a temperature range of 95 to 60 °C. Primers were synthesized by IDT (sequences are listed in Supplementary Table S2). Actin was used as a reference gene. Relative gene expression levels were determined using the standard curve method. Standard-curve points and unknown samples were performed in technical triplicates and replicates, respectively, and at least two biological replicates were analyzed per experimental condition.

Total RNA was isolated from TA and DIAPH muscle using TRIzol (Invitrogen), according to the manufacturer’s recommendations. Total mRNA was reverse transcribed into cDNA using iScript RT Supermix containing oligo (dT) primers and M-MLV reverse transcriptase (1708841, BioRad, Hercules, CA, USA). Quantitative real-time PCR reactions were performed in triplicate using PowerUp SYBR Green Master Mix (Applied Biosystems, Waltham, MA, USA) on an Agilent AriaMx Real-Time PCR System (Agilent Technologies). mRNA expression was quantified with the comparative ΔCt method (2^−ΔΔCt), using 18S as the reference gene. mRNA levels were expressed relative to the mean expression in control rats. Primers set used: Atrogin-1 (Fwd: 5′-TACTAAGGAGCGCCATGGATACT-3′; Rev: 5′-GTTGAATCTTCTGGTATCCAGGAT-3′), rat Murf-1 (Fwd: 5′-GGTGCCTACTTGCTCCTTGTGC-3′; Rev: 5′-AGTCTGAACTCGGTCGTTCCCT-3′), rat Ccn2 (Fwd: 5′-AATGCTGTGAGGAGTGGGTGT-3′; Rev: 5′-GTTGGCTCGCATCATAGTTGG-3′), rat Tgf-β1 (Fwd: 5′-CAACGCAATCTATGACAAAACC-3′; Rev: 5′-ACAAGAGCAGTGAGCACTGAAG-3′), rat Nf-kB (Fwd: 5′-ATGTGGAGATCATTGAGCAGC-3′; Rev: 5′-CCTGGTCCTGTGTAGCCATT-3′), and rat 18S (Fwd: 5′-GTAACCCGTTGAACCCCATT-3′; Rev: 5′-CCATCCAATCGGTAGTAGGC-3′).