The cell lines used in this study included 786–0 human kidney adenocarcinoma cells (ATCC® CRL-1932™), HK-2 human kidney cortex/proximal tubule (ATCC® CRL2190™), and the renal carcinoma cell lines UOK120 and UOK109 (gifts of Dr. W. Marston Linehan, National Cancer Institute, Bethesda, MD). The UOK120 and UOK109 cell lines were derived from primary papillary cell carcinoma as described [20 (link)], and were derived from tumors arising in a 30- and a 39-year-old male, respectively. Cells were cultured in DMEM (Gibco, Grand Island, NY) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA).
Crl 1932
Manufactured by American Type Culture Collection
Sourced in United States
The CRL-1932 is a laboratory equipment product offered by American Type Culture Collection. It is a cell line that serves as a standard research tool. The core function of CRL-1932 is to provide a consistent and reliable source of cells for use in various laboratory experiments and studies.
Automatically generated - may contain errors
Lab products found in correlation
Htb 46, by American Type Culture Collection (4 mentions)
Rpmi 1640, by American Type Culture Collection (3 mentions)
Caki 1, by American Type Culture Collection (3 mentions)
Mccoy s 5a media, by American Type Culture Collection (3 mentions)
Htb 47, by American Type Culture Collection (3 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Oligofectamine, by Thermo Fisher Scientific (2 mentions)
Crl 2190, by American Type Culture Collection (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Crl 1611, by American Type Culture Collection (1 mentions)
Celltiter 96 aqueous one solution cell proliferation assay mts assay kit, by Promega (1 mentions)
Mccoy 5a, by Lonza (1 mentions)
Rpmi 1640, by Lonza (1 mentions)
Penicillin streptomycin, by Lonza (1 mentions)
L glutamine, by Lonza (1 mentions)
1640 medium, by Thermo Fisher Scientific (1 mentions)
Crl 11268, by American Type Culture Collection (1 mentions)
11 protocols using crl 1932
1
Comparative Analysis of Renal Cell Lines
2
Culturing Clear Cell Renal Carcinoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human ccRCC lines 786-O (ATCC® CRL-1932™) and Caki-1 (ATCC® HTB-46™) (American Type Culture Collection, Manassas, VA, USA) were cultured under standard conditions (37 °C, 5% CO2). 786-O, a VHL mutant RCC cell line with altered HIF and VEGF pathways, was derived from a primary epithelial clear cell adenocarcinoma and maintained in RPMI 1640 (ATCC). Caki-1, derived from a metastatic site on the skin, is a VHL wild type RCC cell line characterized by high VEGF production, and was grown in McCoy’s 5A media (ATCC). All media were supplemented with 10% fetal bovine serum, penicillin/streptomycin, and L-glutamine.
3
Transfection of Renal Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal kidney cell HK-2 was purchased from ATCC, which were all cultured with K-SFM complete medium; renal clear cell carcinoma HTB-47 and CRL-1932 cells were purchased from ATCC, which were all cultured with 1640 containing 10% FBS and 1% penicillin-streptomycin double antibody in the incubator with 37°C and 5%CO2. We transfected HTB-47 and CRL-1932 cells with designed NCAPG, CDK1 shRNA, and CDK1 overexpression plasmid according to transfection reagent. These designed NCAPG shRNA sequences were presented: shRNA 1: CCAGAACCAGGCGAAGCTGGTGG; shRNA 2: AAAGACTTTGCCAAAAATTGTAG; shRNA 3: AAAAGAATTCATAGGTCAACAAT; and shRNA 4: TTTGATTCTTCCTGGAATAATAA. And CDK1 shRNA sequences were presented: shRNA 1: CAGGTTATATCTCATCTTT; shRNA 2: ′-GCTTGGATTTGCTCTCGAA and shRNA 3: GGAATCTTTACAGGACTAT. A total of 6 × 105 HTB-47 and CRL-1932 cells were seeded in 6-well plates. After 24 h, the cells were transfected with 2 μg plasmid or 100 nM siRNA with Lipofectamine™ 2000 (Invitrogen) according to the manufacturer's protocol. The related plasmid was transfected into HTB-47 and CRL-1932 cells. The knockdown of NCAPG and CDK1 was generated by transfection with related shRNA.
4
Culturing clear cell renal carcinoma cell lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human ccRCC cell lines 786-O (ATCC® CRL-1932™) and Caki-1 (ATCC® HTB-46™) (American Type Culture Collection, Manassas, VA, USA) were cultured under standard conditions (37°C, 5% CO2). 786-O, a VHL mutant cell line with altered HIF and VEGF pathways derived from a primary epithelial clear cell adenocarcinoma [37 (link)], was maintained in RPMI 1640 (ATCC). Caki-1, a VHL wild type cell line that is derived from a metastatic site on the skin and is characterized by high VEGF production [37 (link)], was grown in McCoy’s 5A media (ATCC). All media were supplemented with 10% fetal bovine serum, penicillin/streptomycin, and L-glutamine.
5
ccRCC cell lines knockdown study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human ccRCC cell lines, HTB-47 and CRL-1932, were obtained from ATCC. Both HTB-47 and CRL-1932 cells were maintained in RPMI1640 medium with 10% fetal bovine serum addition (Gibico, CA, USA) in a 5% CO 2 incubator.
KIF4A shRNA plasmids were transfected into HTB-47 and CRL-1932 cells were conducted using lipofectamine 2000 (11668019, Invitrogen, Carlsbad, CA, USA). Stable knockdown of HTB-47 cells was obtained by its shRNA lentivirus infection and the selection was performed by puromycin supplementation and used in animal experiments.
KIF4A shRNA plasmids were transfected into HTB-47 and CRL-1932 cells were conducted using lipofectamine 2000 (11668019, Invitrogen, Carlsbad, CA, USA). Stable knockdown of HTB-47 cells was obtained by its shRNA lentivirus infection and the selection was performed by puromycin supplementation and used in animal experiments.
6
Culturing and Treating Clear Cell Renal Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
786-O (ATCC®, CRL-1932™) and 769-P (ATCC®, CRL-1933™) early non-metastatic ccRCC cells were maintained in RPMI-1640 medium supplemented with 10 % foetal calf serum, 1 % Glutamax and 1 % Penicillin (10,000 Units/ml)/Streptomycin (10,000 Units/ml). ACHN metastatic ccRCC cells (ATCC®, CRL-1611™) were maintained in Essential Modified Eagle's Medium (EMEM) supplemented with 10 % Foetal calf serum, 1 % Glutamax and 1 % Penicillin (10,000 Units/ml)/Streptomycin (10,000 Units/ml). Cells were authenticated using short tandem repeat DNA profiling. Prior to treatment or siRNA transfection, cells were seeded at a density of 1×105 cells/well for 6-well plates and 5×103 cells/well for 96-well plates then incubated at 37 °C with 5 % CO2 in air for 24 h. Inhibitor treatments were then performed as appropriate; dasatinib was added for 48 h and saracatinib for 24 h at 37 °C with 5 % CO2 in air.
7
Evaluating Cell Proliferation in Clear Cell Renal Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human clear cell renal carcinoma Caki-1 (Caki-1ATCC® HTB46™), 786-O (ATCC® CRL1932™), and A-498 (ATCC® HTB 44™) cells (purchased from American Type Culture Collection (ATCC) were cultured in McCoy5A, RPMI-1640 and EMEM medium (Lonza), respectively, supplemented with 10% FBS. All experiments were performed with mycoplasma-free cells. All media were supplemented with 1% l -Glutamine and 1% penicillin/streptomycin (Lonza). Cells were incubated at 37 °C and 5% CO2.
To assess cell proliferation/viability of Caki-1, A-498 and 786-O cells, 3500, 1500, and 1500 cells, respectively, were plated per well in 96-well culture plates. A day after plating the cells, different concentrations of dichloroacetate (DCA; Sigma Aldrich) or vehicle were added. Cell proliferation was measured with the CellTiter 96® AQueous One Solution Cell Proliferation Assay Kit (MTS Assay, Promega) in 96-well plates, and absorbance was measured at 490 nm using microplate reader 72 h post treatment (BioRad).
To assess cell proliferation/viability of Caki-1, A-498 and 786-O cells, 3500, 1500, and 1500 cells, respectively, were plated per well in 96-well culture plates. A day after plating the cells, different concentrations of dichloroacetate (DCA; Sigma Aldrich) or vehicle were added. Cell proliferation was measured with the CellTiter 96® AQueous One Solution Cell Proliferation Assay Kit (MTS Assay, Promega) in 96-well plates, and absorbance was measured at 490 nm using microplate reader 72 h post treatment (BioRad).
8
Cell Culture of Renal Cell Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human ccRCC cell lines 786-O (ATCC® CRL-1932™) and Caki-1 (ATCC® HTB-46™) (American Type Culture Collection, Manassas, VA, USA) were cultured under standard conditions (37 °C, 5% CO2). A VHL mutant primary epithelial clear cell adenocarcinoma with altered HIF and VEGF pathways [35 (link)], 786-O, was grown in RPMI 1640 (ATCC). Caki-1, a VHL wild type model line of metastatic ccRCC with high VEGF production [35 (link)], was maintained in McCoy’s 5A media (ATCC). All media were supplemented with 10% fetal bovine serum, penicillin/streptomycin, and L-glutamine.
9
Profiling Clear Cell Renal Cell Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human epithelial cell lines established human cells 293T (CRL-11268, ATCC, USA) and tumorous kidney-ACHN (ZQ0340, CHINA) were cultured in Dulbecco's modi ed Eagle's medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen) and penicillin (100 U/ml). The cell lines established from ccRCC patients-786-0 (CRL-1932, ATCC, USA) and OSRC-2 were maintained in 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen) and penicillin (100 U/ml). The Caki-2 (HTB-47, ATCC, USA) was cultured in McCoy's 5a Medium Modi ed supplemented with 10% fetal bovine serum (FBS; Invitrogen) and penicillin (100 U/ml). All cell lines were maintained at 5% CO 2 , at 37•C.
The cDNA microarray containing samples of ccRCC (n=15) and matched adjacent tissues were purchased from Shanghai OUTDO Biotech Co., Ltd. (Shanghai, China; Cat no: me cDNA-HKidE030CS01). The array was supplemented with corresponding clinicopathological information, including gender, age, pathological classi cation, and distant metastasis.
Seventeen cases of clear cell carcinoma of kidney and adjacent tissues were acquired from the Department of Pathology, A liated Tumor Hospital of Guangxi Medical University from January 2015 to March 2017. All patients signed informed consent forms.
The cDNA microarray containing samples of ccRCC (n=15) and matched adjacent tissues were purchased from Shanghai OUTDO Biotech Co., Ltd. (Shanghai, China; Cat no: me cDNA-HKidE030CS01). The array was supplemented with corresponding clinicopathological information, including gender, age, pathological classi cation, and distant metastasis.
Seventeen cases of clear cell carcinoma of kidney and adjacent tissues were acquired from the Department of Pathology, A liated Tumor Hospital of Guangxi Medical University from January 2015 to March 2017. All patients signed informed consent forms.
10
HIF2α Knockdown in Renal Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both 786-0 cells (obtained from the American Type Culture Collection (ATCC®), CRL-1932™) and RCC4 cells, gift from W. Kaelin 25 , were cultured in DMEM low glucose medium (1g/L) supplemented with 10% FBS no longer than 20 passages. They were mycoplasma tested every 3 months and all of them were authenticated using DNA STR analysis. 786-0 wild type (786-0 WT) cell line is VHL defective and contains an inactivating mutation in HIF1α gene, leading to constitutive expression of HIF2α. RCC4 VHL mutant cell line stably expressing an empty vector (RCC4 WT) or a vector for VHL overexpression (RCC4 VHL) were used.
Transfection of HIF2α siRNA (siHIF2α) and siRNA control (siCON) (Supplementary table 1) was performed with 12000 cells using Optimem reduced serum medium at a nal concentration of 20nM.
Oligofectamine (12252-011, Thermo Fisher) was used following the manufacturer's instructions.
Transfection of HIF2α siRNA (siHIF2α) and siRNA control (siCON) (Supplementary table 1) was performed with 12000 cells using Optimem reduced serum medium at a nal concentration of 20nM.
Oligofectamine (12252-011, Thermo Fisher) was used following the manufacturer's instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!