High capacity rna to dna kit

Manufactured by Thermo Fisher Scientific

Sourced in Germany, United States

The High Capacity RNA to DNA kit is a laboratory tool designed to efficiently reverse transcribe RNA into complementary DNA (cDNA). The kit provides reagents and protocols for the conversion of RNA samples into cDNA, which can be used for downstream applications such as gene expression analysis, PCR, and sequencing.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

High Capacity RNA-to-complementary DNA Kit High Capacity Kit

29 protocols using high capacity rna to dna kit

Wnt Signaling Regulation in VSMC

Check if the same lab product or an alternative is used in the 5 most similar protocols

To study effects of CM on Wnt5a expression and of the Wnt agonist I on MMP-2 and MMP-9 expression in VSMC, the cells were treated as indicated for 24 h and total RNA was isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) and transcribed into cDNA with the High Capacity RNA to DNA kit (Applied Biosystems, Foster City, CA, USA). The cDNA concentrations were determined by a NanoDrop ND-1000 device (NanoDrop Technologies, Wilmington, NC). Quantitative PCR using SYBR Green Master Mix (Applied Biosystems) and subsequent melting curve analysis was performed using the Mx3000p system (Stratagene/Agilent Technologies, Waldbronn, Germany). Relative RNA amounts were calculated using the 2^−ΔΔCt method and normalized to mRNA expressions of the housekeeping genes YWAHZ (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide) and HPRT (hypoxanthine-phophoribosyl transferase). The primers sequences were: Wnt5a: forward primer, 5′-CAAATAGGCAGCCGAGAGAC-3′, reverse primer, 5′-CTCTAGCGTCCACGAACTCC-3′; MMP-2: forward primer, 5′-CAGGGAATGAGTACTGGGTCTATT-3′, reverse primer, 5′-ACTCCAGTTAAAGGCAGCATCTAC-3′; MMP9: forward primer, 5′-AATCTCTTCTAGAGACTGGGAAGGAG-3′, reverse primer, 5′-AGCTGATTGACTAAAGTAGCTGGA-3′ (BioTez Berlin-Buch GmbH, Berlin, Germany).

Freise C., Kretzschmar N, & Querfeld U. (2016). Wnt signaling contributes to vascular calcification by induction of matrix metalloproteinases. BMC Cardiovascular Disorders, 16, 185.

+ Open protocol

+ Expand

Quantitative PCR Analysis of VSMC

Check if the same lab product or an alternative is used in the 5 most similar protocols

VSMC in 6-well tissue culture plates at ~90% confluency were serum starved for 24 h in standard culture medium containing 0.2% FBS. Cells were then treated for 24 h as indicated. Total RNA was isolated and transcribed into complementary DNA (cDNA) with the RNeasy Mini Kit (Quiagen, Hilden, Germany) and the High Capacity RNA to DNA kit (Applied Biosystems, Foster City, CA, USA), respectively. Quantitative PCR using SYBR Green Master Mix (Applied Biosystems) was performed on MxPro-system from Stratagene (Agilent Technologies, Santa Clara, CA, USA). The relative amount of RNA was calculated using the 2^−ΔΔCt method and normalized to mRNA expressions of the housekeeping genes YWAHZ (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide) or HPRT (hypoxanthine phosphoribosyltransferase). The primer sequences used are available on demand. All measurements were performed in triplicate.

Freise C., Kim K.Y, & Querfeld U. (2015). A Lindera obtusiloba Extract Blocks Calcium-/Phosphate-Induced Transdifferentiation and Calcification of Vascular Smooth Muscle Cells and Interferes with Matrix Metalloproteinase-2 and Metalloproteinase-9 and NF-κB. Evidence-based Complementary and Alternative Medicine : eCAM, 2015, 679238.

+ Open protocol

+ Expand

Quantifying Gene Expression in Brain Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified from corresponding brain tissues (CO, BG, TH, and CE) using PureLink RNA Mini Kit (Life Technologies, Grand Island, NY) according to the manufacturer’s protocol. High capacity RNA-to-DNA Kit (Applied Biosystems) was used for reverse transcription according to the manufacturer’s protocol. The RT-PCR was performed in a StepOnePlus real-time PCR System (Applied Biosystems) using the 2x SYBR Green qPCR Master Mix (Biotool). Reactions were performed in duplicates in MicroAmp optical 96-well plates in a total volume of 10 μL comprising the final concentration of 1× SYBR Green PCR Master mix, cDNA (10 ng), and primers (75 nM, forward and reverse primers listed in Table 2). The following thermal protocol was used: initial incubation at 95°C for 10 min, 40 cycles of 15 s at 95°C, and 1 min at 60°C. Cycle threshold (ct) values of individual genes were subtracted from Ct values for hypoxanthine phosphoribosyltransferase 1 (HPRT1, a hypoxia-stable housekeeping gene), and were then used to calculate fold change in relative gene expression (2^−ΔΔCT). At least 3 animals were tested in each group. Results were compared to saline controls in each batch of samples analyzed.

Shi Z., Vasquez-Vivar J., Luo K., Yan Y., Northington F., Mehrmohammadi M, & Tan S. (2019). Ascending Lipopolysaccharide-induced Intrauterine Inflammation in Near Term Rabbits Leading to Newborn Neurobehavioral Deficits. Developmental neuroscience, 40(5-6), 534-546.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from sorted populations as described for RNA sequencing. cDNA was prepared using the High-Capacity RNA-to-DNA Kit (Applied Biosystems). Real time PCR reactions were carried out using SYBR Green Master Mix (Roche) and run on a Lightcycler 480 II (Roche). Relative mRNA abundance between samples was calculated with the ΔΔC_T method using Gapdh as an internal control. The specific primer sequences used for qRT-PCR in this study are listed in Supplementary Table 2.

King B., Boccalatte F., Moran-Crusio K., Wolf E., Wang J., Kayembe C., Lazaris C., Yu X., Aranda-Orgilles B., Lasorella A, & Aifantis I. (2016). The ubiquitin ligase HUWE1 regulates hematopoietic stem cell maintenance and lymphoid commitment. Nature immunology, 17(11), 1312-1321.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Tissue-Specific RNA and DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

From human adipose tissue, total mRNA for gene expression was extracted by the RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) and for methylation studies, DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). The concentration of mRNA was determined with a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE). The mRNA integrity was analyzed by an Experion Automated Electrophoresis system (Bio-Rad Laboratories, Hercules, CA, USA). From rat inguinal (subcutaneous) adipose tissue, total RNA was isolated by the RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) and cDNA was prepared using the High Capacity RNA to DNA kit (Applied Biosystems, Hercules, CA, USA).

Kokosar M., Benrick A., Perfilyev A., Nilsson E., Källman T., Ohlsson C., Ling C, & Stener-Victorin E. (2018). A Single Bout of Electroacupuncture Remodels Epigenetic and Transcriptional Changes in Adipose Tissue in Polycystic Ovary Syndrome. Scientific Reports, 8, 1878.

+ Open protocol

+ Expand

Quantitative Analysis of RASSF1/RASSF1A in Neurofibromas and MPNSTs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from 5 neurofibromas and 27 MPNSTs using Trizol (Invitrogen) and converted to cDNA using the High Capacity RNA-to-DNA Kit (Applied Biosystems) according to the manufacturer's protocol.
Twenty nanograms of cDNA was amplified in a 20-μL reaction volume containing 1× TaqMan Universal PCR Mastermix (Applied Biosystems) and predesigned 1× TaqMan Gene Expression Assays (Applied Biosystems; RASSF1, Hs 00200394_m1; RASSF1 isoform A, Hs 00945257_m1) using the following PCR program: 50°C for 2 min, 95°C for 10 min, then 45 cycles of 95°C for 15 s followed by 60°C for 1 min. The quantitative gene expression of RASSF1/RASSF1A was measured in real time using the 7900 HT Sequence Detection System (TaqMan, Applied Biosystems). All samples were analyzed in triplicate, and the median value was used for further data analyses. Universal Human Reference RNA (a mixture of total RNA from 10 different cell lines; Agilent) was used to generate a standard curve, and the quantitative expression levels of RASSF1 and RASSF1A were normalized against the mean value of the endogenous controls ACTB (Hs99999903_m1) and GUSB (Hs99999908_m1).

Danielsen S.A., Lind G.E., Kolberg M., Høland M., Bjerkehagen B., Sundby Hall K., van den Berg E., Mertens F., Smeland S., Picci P, & Lothe R.A. (2014). Methylated RASSF1A in malignant peripheral nerve sheath tumors identifies neurofibromatosis type 1 patients with inferior prognosis. Neuro-Oncology, 17(1), 63-69.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by using RNeasy Mini Kit (Cat: 74104) purchased from QIAGEN, the reverse transcription reaction was performed by using High-Capacity RNA-to-DNA KIT (Cat: 4387406) from Applied Biosystems. Total RNA (1 μg) was used for reverse transcription in a 20 μL system according to the protocol provided by manufacturer. Then, the cDNA templates were used for PCR in SYBR select Master Mix for CFX system (Cat: 4472942). qRT-PCR analysis was performed according to the manufacture's recommendations (Denaturation at 95°C for 2 min, followed by 46 cycles of 95°C for 15 s, 60°C for 1 min) in a CFX96 Real-Time PCR Detection System (Bio-Rad, USA). The primers used in qRT-PCR were listed as Table 2 (Table 2). The comparative Ct method, also referred to as the 2^−ΔΔCt, was used to present relative gene expression (ΔCt = Ct gene of interest Ct GAPDH, ΔΔCt = ΔCt sample of treated ΔCt sample of control) [34 (link)].

Long C., Lai Y., Li J., Huang J, & Zou C. (2018). LPS promotes HBO1 stability via USP25 to modulate inflammatory gene transcription in THP-1 cells. Biochimica et biophysica acta. Gene regulatory mechanisms, 1861(9), 773-782.

+ Open protocol

+ Expand

Quantitative Analysis of MISIIR mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Measurement of mRNA expression was performed using a two-step real time polymerase chain reaction (qRT-PCR) process utilizing RNA extract from cryopulverized tumor samples of PDXs. The RNA was converted to cDNA using the High Capacity RNA-to-DNA kit (Applied Biosystems, Carlsbad, CA) on the BioRad iCycler (Hercules, CA). Gene-specific primers were used to amplify exons 7 and 8 of MISIIR (OriGene, Rockville, MD), forward primer: GCCTGGCATTTCTCCATGAGGA and reverse primer: CAGGTCTCCAATGGCACACGAT. The qRT-PCR protocol was performed on the LightCycler^® 480 II (Roche, Indianapolis, IN) as follows: denaturation at 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds (s) and 60°C for 60 s with a final elongation step at 72°C for 60 s. The concentration of MISIIR mRNA was determined by fluorescence detection with Power SYBR green PCR Master mix (Applied Biosystems, Carlsbad, CA) in triplicate and normalized to the expression of the housekeeping gene, RPL19. Due to the relative abundance of RPL19, the normalized ratio of MISIIR:RPL19 was multiplied by a factor of 10⁵.

Gill S.E., Zhang Q., Keeney G.L., Cliby W.A, & Weroha S.J. (2017). Investigation of factors affecting the efficacy of 3C23K, a human monoclonal antibody targeting MISIIR. Oncotarget, 8(49), 85214-85223.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Signaling Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was isolated from BEAS-2B cell lines using a RNeasy Mini Kit (Cat#: 74104) purchased from QIAGEN. High-capacity RNA-to-DNA kit (Cat#: 4387406, Applied Biosystems) was applied to synthesize cDNA from 1 μg of total RNA in the reverse transcription reaction. qRT-PCR was performed in a Bio-Rad CFX96 Real-Time PCR system with a cycling program (50° C for 2 min, 95° C for 2 min, followed by 39 cycles of 95° C for 15 sed, 55° C for 15sec, and 72° C for 1 min). The primers used in qRT-PCR were listed below: PRMT6 forward: 5′-CAAGACACGGACGTTTCAG-3′ and reverse: 5′-CCTGGTCTCCCACTTTGTA -3′, PDK1 forward: 5′-CCAGTCCAGCGTGGTGTTATG-3′ and reverse: 5′-CCGGTTTAAGGTCCCTGTGAATG-3′, PIK3R1 forward: 5′-GTGGACCTCATCAATCACTAC-3′ and reverse: 5′-CCAGCCACTCGTTGATTT-3′, PIK3R2 forward: 5′-CTCTACCCTGTGTCCAAATAC-3′ and reverse: 5′-CTTGTCGATCTCTCTGTTGTC-3′, PTEN forward: 5′-CCACCACAGCTAGAACTTATC-3′ and reverse: 5′-GACTCAGTGGTGTCAGAATATC -3′, GAPDH forward: 5′-GTATGACAACAGCCTCAAGAT-3′ and reverse: 5′-GTCCTTCCACGATACCAAAG-3′. The relative mRNA level of interest gene was presented as compare to GAPDH mRNA [56 (link)].

Li T., Fanning K.V., Nyunoya T., Chen Y, & Zou C. (2020). Cigarette smoke extract induces airway epithelial cell death via repressing PRMT6/AKT signaling. Aging (Albany NY), 12(23), 24301-24317.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!