Sybr green mix

Manufactured by Merck Group

Sourced in United States

SYBR Green mix is a ready-to-use solution containing SYBR Green I dye, which is a fluorescent dye that binds to double-stranded DNA. It is commonly used in real-time PCR (qPCR) and other DNA quantification applications.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) Cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) 96 multiwell plate, by Roche (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Nanodrop 1000, by Thermo Fisher Scientific (2 mentions) Cfx96 real time system c1000 thermal cycler, by Bio-Rad (1 mentions) Tri reagent, by Merck Group (1 mentions) 1 bromo 3 chloropropane, by Merck Group (1 mentions) Dnase 1, by Roche (1 mentions) Specific primers, by Merck Group (1 mentions) Nanodrop 2000, by Thermo Fisher Scientific (1 mentions) A real time pcr system, by Bio-Rad (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions) Fenozol, by A&A Biotechnology (1 mentions) Steponeplustm real time pcr system, by Thermo Fisher Scientific (1 mentions) Epishear, by Active Motif (1 mentions) Protein g dynabead, by Thermo Fisher Scientific (1 mentions) Transcriptor first strand cdna synthesis kit, by Roche (1 mentions) Rnaeasy mini kit, by Qiagen (1 mentions)

10 protocols using sybr green mix

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted using TRI reagent (Sigma) and 1-bromo-3-chloropropane (Sigma) according to the procedure of the manufacturer. RNAs were precipitated with half volume of isopropanol and half volume of high salt precipitation buffer (0.8 M sodium citrate and 1.2 M sodium chloride). RNA samples were treated with DNaseI (Roche) and purified by RNeasy Mini Kit (Qiagen) according to the procedure of the manufacturers.
Total RNAs (3 µg) were used for generating cDNAs in a 20 µl volume reaction according to Invitrogen Superscript II Reverse Transcriptase protocol. The obtained cDNAs were diluted five times, and 1 µl were used for 10 µl qPCR reaction.
qPCR was performed in 10 µl final volume using 5 µl SYBR Green mix (Sigma), 1 µl diluted cDNAs, and primers. qPCR was run on the CFX96 Real-Time System C1000 thermal cycler (Biorad) using the following program: (1) 95°C, 3 min; (2) [95°C, 30 sec, then 60°C, 30 sec, then 72°C, 30 sec]×45, 72°C, 10 min followed by a temperature gradient from 55°C to 95°C. The relative expression values were determined using EF-1α (At5g60390) as a reference gene and the comparative cycle threshold method (2^−ΔΔCt). Primers used for qPCR are listed in Table S10.

Asai S., Rallapalli G., Piquerez S.J., Caillaud M.C., Furzer O.J., Ishaque N., Wirthmueller L., Fabro G., Shirasu K, & Jones J.D. (2014). Expression Profiling during Arabidopsis/Downy Mildew Interaction Reveals a Highly-Expressed Effector That Attenuates Responses to Salicylic Acid. PLoS Pathogens, 10(10), e1004443.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the RNeasy mini kit (#74106, Qiagen) according to the manufacturer’s introduction. RNA quality was assessed using NanoDrop 2000 and a total of 400ng RNA were used for reversed transcription using High-Capacity cDNA Reverse Transcription Kit (#4375575, ABI) with random primers. Quantitative real-time PCR was performed by BIO-RAD CFX96 real time PCR system with SYBR Green Mix and specific primers (Sigma). Data were normalized to the expression of housekeeping GAPDH gene and the relative abundance of transcripts was calculated by the 2^−ΔΔCt method.

Dou Y., Xing J., Kong G., Wang G., Lou X., Xiao X., Vivier E., Li X.C, & Zhang Z. (2019). Identification of the E3 ligase TRIM29 as a critical checkpoint regulator of natural killer cell functions. Journal of immunology (Baltimore, Md. : 1950), 203(4), 873-880.

+ Open protocol

+ Expand

Imaginal Disc RNA Isolation and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Imaginal disc tissues (including brain) were dissected and total RNA was isolated using TRIzol (Invitrogen) for RT-PCR. Total RNA (2 μg) was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase (Promega) and random primers following the protocol of the manufacturer. PCR was performed in triplicate using SYBR Green Mix (Sigma) and a real-time PCR system (Bio-Rad). The Primer sequences were: tefu(F): GGGATTCGATAAACTGGC; tefu(R): AAAGGCAGCAGGCAGGTC; Rad50(F): CGGAGTTTCGGCACCTATG; Rad50(R): TCTTTCCGCATCCGTTCTC; Rp49(F) ACAGGCCCAAGATCGTGAAGA; and Rp49(R) CGCACTCTGTTGTCGATACCCT.

Pei X., Du E., Sheng Z, & Du W. (2020). Rb family-independent activating E2F increases genome stability, promotes Homologous Recombination, and decreases Non-Homologous End Joining. Mechanisms of development, 162, 103607.

+ Open protocol

+ Expand

Quantitative PCR of FFPE Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from paraffin tissues using FFPE-RNA isolation kit (RTA) and reverse transcribed using cDNA reverse transcription kit (Thermo Fisher) according to manufacturer’s protocols. Quantitative PCR was done using SYBR Green mix (Sigma Aldrich). Reactions were performed in triplicate in a 96-multiwell plate (Roche). Gene expressions were normalized to 18S rRNA, and fold differences were calculated using the comparative CT method: 2-(ΔΔCT), where ΔΔCT refers to (normalized control sample) − (normalized treated sample) as previously described [6 (link)].

Saygideger Y., Avci A., Bagir E., Saygıdeğer Demir B., Sezan A., Ekici M., Baydar O, & Erkin Ö.C. (2022). Slug and Vimentin downregulation at the metastatic site is associated with Skip-N2 metastasis of lung adenocarcinoma. Discover. Oncology, 13, 7.

+ Open protocol

+ Expand

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated according to Chomczynski and Sacchi [26 (link)] using Fenozol (A&A Biotechnology, Gdynia, Poland). Reverse transcription was performed with RevertAid Reverse Transcriptase polymerase (Thermo Fisher Scientific, Waltham, MA, USA) after confirmation of the RNA concentration and purity on a NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA)F. qRT-PCR with SybrGreen Mix (Sigma-Aldrich, St. Louis, MO, USA) was performed using specific primers (Table 1). Eukaryotic translation elongation factor 2 (EEF2) was used for gene expression normalization. The reaction was performed using a StepOnePlus TM Real-time PCR System (Applied Biosystems, Foster City, CA, USA). The relative gene expression level was calculated as 2^−ΔC_T, where ΔC_T is defined as a difference between C_T values obtained for the gene of interest and housekeeping gene EEF-2. Data were normalized to the control cells.

Podkalicka P., Mucha O., Kruczek S., Biela A., Andrysiak K., Stępniewski J., Mikulski M., Gałęzowski M., Sitarz K., Brzózka K., Józkowicz A., Dulak J, & Łoboda A. (2020). Synthetically Lethal Interactions of Heme Oxygenase-1 and Fumarate Hydratase Genes. Biomolecules, 10(1), 143.

+ Open protocol

+ Expand

ChIP-qPCR Assay for MITF Binding

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation was performed as described (Shaffer et al., 2008) with the following modifications: Thirty million cells were crosslinked with 0.4% formaldehyde, and chromatin was sheared by sonication using a probe sonicator (Epishear, Active Motif). Immunoprecipitation was performed with Protein G Dynabeads (10003D, Life technologies), with a total of 10 µg of anti-MITF antibody (Cosmo Bio Co., BAM-73-107-EX)^{47 (link)}. Purified ChIP samples and corresponding input DNA were analysed by qRT-PCR using SYBR-Green mix (#4438, Sigma-Aldrich) on an ABI 7500 qPCR machine (annealing at 60 °C) using region specific primers (Sup. Table 6). The resulting qPCR data were then analysed as described above.

Möller K., Sigurbjornsdottir S., Arnthorsson A.O., Pogenberg V., Dilshat R., Fock V., Brynjolfsdottir S.H., Bindesboll C., Bessadottir M., Ogmundsdottir H.M., Simonsen A., Larue L., Wilmanns M., Thorsson V., Steingrimsson E, & Ogmundsdottir M.H. (2019). MITF has a central role in regulating starvation-induced autophagy in melanoma. Scientific Reports, 9, 1055.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cell lines using an RNAeasy mini kit (Qiagen) and reverse transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche) according to manufacturer’s protocols. Quantitative PCR was done on an Eppendorf Mastercycler using SYBR Green mix (Sigma Aldrich). Reactions were performed in triplicate in a 96-multiwell plate (Eppendorf, #30132700). Gene expressions were normalized to 18S rRNA, and fold differences were calculated using the comparative CT method: 2^−(ΔΔCT), where ΔΔCT refers to (normalized control sample) − (normalized treated sample). Primer pairs were as follows—18S rRNA: sense: 5′-cttagagggacaagtggcg-3′, antisense: 5′-acgctgagccagtcagtgta-3′; aurora kinase A: sense: 5′-tctagtcctccttaaccacttatct-3′, antisense: 5′-gacacatggcctcttctgtatc-3′; COX2: sense: 5′-tgtacccggacaggattcta-3′, antisense: 5′-cccttgaagtgggtaagtatgt-3′; iNOS: sense: 5′-aaggtctacgttcaagacatcc-3′, antisense: 5′-gcacatcgccacaaacatag-3′; cyclin D1: sense: 5′-gggttgtgctacagatgatgag-3′, antisense: 5′-agacgcctcctttgtgttaat-3′.

Saygideğer-Kont Y., Minas T.Z., Jones H., Hour S., Çelik H., Temel I., Han J., Atabey N., Erkizan H.V., Toretsky J.A, & Üren A. (2016). Ezrin Enhances EGFR Signaling and Modulates Erlotinib Sensitivity in Non–Small Cell Lung Cancer Cells. Neoplasia (New York, N.Y.), 18(2), 111-120.

+ Open protocol

+ Expand

Quantitative PCR Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Briefly, total RNA was extracted from tissue and cell samples using TransZol Up Plus RNA Kit (TransGen Biotech, ER501-01). Subsequently, the total RNA was reverse transcribed into double-stranded cDNA using SuperScript™ IV Reverse Transcriptase (Thermo Fisher, 18090010). Then the qPCR was performed in a total reaction volume of 10 µL containing 5 µL SYBR Green Mix (KCQS00, Sigma Aldrich), 3.6 µL DEPC-H₂O, 0.2 µL forward primer, 0.2 µL reverse primer, and 1 µL cDNA (Total amount: 10 ng-100 ng). A two-step method was used: denaturation temperature of 95 °C for 30 s, annealing and extension of 60 °C for 30 s. The details were previously described [36 (link)]. The primers are shown in Tables S2 and S3.

Zhang G., Guo J., Yang H., Li Q., Ye F., Song Y., Xiong D., Zeng J., Zhi W., Yuan S., Lv Y., Li T., Wang Y., Liao L., Deng D., Liu W, & Xu W. (2024). Metabolic profiling identifies Qrich2 as a novel glutamine sensor that regulates microtubule glutamylation and mitochondrial function in mouse sperm. Cellular and Molecular Life Sciences: CMLS, 81(1), 170.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using TRIzol reagent (#15596-026, Ambion), DNase treated using the RNase free DNase kit (#79254, Qiagen) and re-purified with the RNeasy Mini kit (#74204, Qiagen). The cDNA was generated with High-Capacity cDNA Reverse Transcription Kit (#4368814, Applied Biosystems). All procedures were performed according to manufacturer’s instructions. Primers were designed for each target gene using NCBI Primer BLAST (Sup. Table 5), and qRT-PCR was performed with SYBR-Green mix (#4438, Sigma-Aldrich) using an Applied Biosystems 7500 qPCR machine (annealing at 60 °C). The qRT-PCR reactions were performed using 5 ng cDNA per 20 µl reaction, in triplicates and relative gene expression was calculated with the D-ΔΔCt method^{46 (link)}, using the geometric mean of β-Actin and human ribosomal protein lateral stalk subunit P0 (RPLP0) expression to normalise gene expression of target genes. Standard curves were made for each primer pair and the efficiency calculated using the formula E = 10[−1/slope].

+ Open protocol

+ Expand

Quantitative PCR Analysis of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from para n tissues using FFPE-RNA isolation kit (RTA) and reverse transcribed using cDNA reverse transcription kit (Thermo Fisher) according to manufacturer's protocols. Quantitative PCR was done using SYBR Green mix (Sigma Aldrich). Reactions were performed in triplicate in a 96multiwell plate (Roche). Gene expressions were normalized to 18S rRNA, and fold differences were calculated using the comparative CT method: 2-(ΔΔCT), where ΔΔCT refers to (normalized control sample) -(normalized treated sample) as previously described [6].

Saygıdeğer Y., Avcı A., Bağır E., Demir B.S., Sezan A., Ekici M., Baydar O., & Erkin Ö.C. (2021). Slug and Vimentin Downregulation at the Metastatic Site is Associated with Skip-N2 Metastasis of Lung Adenocarcinoma.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!