Apali restriction enzyme

We prepared HEK293T/17 cells (ATCC CRL-11268) stably expressing PTP1B_PS** or PTP1B_PS(C450M) by following standard protocols. In brief, we grew the cells in 75 cm² culture flasks (Corning) with DMEM media supplemented with 10% FBS, 100 units/ml penicillin, and 100 units/ml streptomycin. When cells achieved 60–80% confluency, we transfected them with (i) 2000 ng of plasmid DNA (pAcGFP1-C1 with PTP1B_PS** or PTP1B_PS**(C450M), but no GFP) linearized with the ApaLI restriction enzyme (New England Biolabs) and (ii) 6 μl of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols. We passaged the cells in our growth media (as above) supplemented with 1.5 µg/mL puromycin, and we replaced the media every day for 10 days. We passaged the cells seven times before freezing them for further use.

The method to study the effect of peptide treatment on in vitro expression of protein was adapted from previous study (Taniguchi et al., 2016 (link)). RTS^TM 100 E. coli HY Kit (biotechrabbit) was used as a cell-free rapid translation system (RTS) to express green fluorescent protein (GFP) with or without peptide treatment. Streptomycin (Sigma-Aldrich), an antibiotic functioning as an inhibitor of bacterial translation, was used as a positive control. Reaction mixture was prepared as described in the product manual. For the negative control, the remaining 10 μl was topped up with nuclease-free water while for the other reactions, the 10 μl consists of 5 μg GFP mRNA and either nuclease-free water or the indicated treatment (100 μM Pen, Pen-BR, Pen-RRR, CapM2 or 10 μM Streptomycin). Reaction was incubated at 30°C for 6 h before being analyzed with Western blot for the protein level of GFP. To obtain GFP mRNA, control GFP expression vector was first linearized using ApaLI restriction enzyme (New England Biolabs) and then separated via agarose gel electrophoresis. Fragment containing the linearized GFP expression vector was retrieved using FavorPrep GEL Purification Kit (FAVORGEN Biotech Corp.) and subsequently used as the template for MEGAscript^TM T7 Transcription Kit (Thermo Fisher Scientific) to generate GFP mRNA.

Southern blot analysis was performed as previously described^{28 (link)}. Briefly, genetic DNA was isolated from mouse pancreatic tissues of indicated mice. The Cre-specific oligonucleotide probes were PCR-amplified from Ki67-CrexER vector and labeled with digoxigenin-dUTP by a PCR DIG probe synthesis Kit (Roche diagnostics, GmbH, Germany). The primer pairs for DNA probes amplification were Probe-F: ACGTATAGCCGAAATTGCCAGGA and Probe-R: CAGAGTCATCCTTAGCGCCGTAA. 30 μg DNA was digested with ApaLI restriction enzyme (NEB, Massachusetts, US) overnight at 37 °C, and then separated on the 0.8% agarose gel and blotted with the positively charged nylon membrane (Roche diagnostics, GmbH, Germany). According to the protocol of the DIG easy hybridization Kit (Roche diagnostics, GmbH, Germany), the DNA was exposed to UV, prehybridized and hybridized. Then the probes were washed and blocked. The detection of hybrid products was performed according the CDP-Star (Roche diagnostics, GmbH, Germany) and the membrane was exposed to X-ray at room temperature for 20 min.