The largest database of trusted experimental protocols

Sybr green mix kit

Manufactured by Thermo Fisher Scientific
Sourced in United States

The SYBR Green mix kit is a reagent used in quantitative real-time PCR (qPCR) assays. It contains a fluorescent dye that binds to double-stranded DNA, allowing for the detection and quantification of target DNA sequences during the PCR reaction.

Automatically generated - may contain errors

32 protocols using sybr green mix kit

1

Quantification of Apoptosis-related Genes in Rat Testis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the rat testis tissue samples using TRIzol reagent (Invitrogen; Thermo Fisher Scientific Inc.), and the RNA concentration was measured by spectrophotometry. First-strand cDNA was synthesized using a cDNA synthesis kit (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol. Subsequently, RT-qPCR was applied to the SYBR-Green mix kit (Applied Biosystems; Thermo Fisher Scientific Inc.). The primers for Hsp70, caspase-3 and caspase-9 were designed as follows: Hsp70 forward, 5′-ATGCTTCAGACCTCCCTT-3′ and reverse, 5′-CTCCACCAACTATCTCCACT-3′; caspase-3 forward, 5′-TGGACTGCGGTATTGAGACA-3′ and reverse, 5′-GCGCAAAGTGACTGGATGAA-3′; caspase-9 forward, 5′-CAAGAAGAGCGGTTCCTGGT-3′ and reverse, 5′-CAGAAACAGCATTGGCGACC-3′; GAPDH was used as a housekeeping gene. The data were measured as a ratio of each mRNA relative to GAPDH mRNA (forward, 5′-ACAGCAACAGGGTGGTGGAC-3′ and reverse, 5′-TTTGAGGGTGCAGCGAACTT-3′). PCR was performed with 40 cycles of 94°C for 30 sec, followed by 56°C for 30 sec and 72°C for 25 sec, using the ABI 7900 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific Inc., Waltham, MA, USA).
+ Open protocol
+ Expand
2

Quantitative Gene Expression Analysis in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cancer cells by using TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After that, all RNAs were reversed transcribed into cDNA using a reverse transcription reagent kit (Takara Biotechnology, Dalian, China). Real-time quantitative PCR was performed via an Applied Biosystems SYBR-Green mix kit and the ABI 7900 Real-Time PCR system (Applied Biosystems Life Technologies, Foster City, CA, USA). Primer sequences are shown in Table I. Relative mRNA expression was normalized to GAPDH. The relative amount of mRNA was calculated using the 2−∆∆Cq method (17 (link)). All primers are shown in Table I.
+ Open protocol
+ Expand
3

Quantifying Elastin Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from samples using RNeasy mini kit (Qiagen) and the resulting RNAs were reverse transcribed using Superscript III Reverse Transcriptase (Life Technologies). Real-time quantitative PCR (qPCR) was performed using a StepOne thermocycler with a Sybr green mix kit (Applied Biosystems). Primer sequences were chosen for Eln (forward: GGTGTCCCAGGTGTGGTG, reverse: GAAGCGGATACCTGCTCCA) and housekeeping gene Actb (forward: CTGTGCCCATCTATGAAGGCTA, reverse: ATTTCTCTCTCGGCTGTGGTG)[62 (link)]. The relative expression of Eln was measured by the 2-ΔΔCt method and normalized for the housekeeping gene Actb.
+ Open protocol
+ Expand
4

Extraction and Analysis of TUSC3 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Extraction of total RNA from clinical specimens and cancer cells was performed using the TRIzol® RNA Reagent kit (Takara Bio, Inc., Otsu, Japan). RT of RNA into cDNA was conducted using the Applied Biosystems SYBR Green mix kit (cat. no. 163795-75-3; Shanghai Aladdin Biochemical Company, Shanghai, China), according to the manufacturer's protocol. The primer sequences for TUSC3 and GAPDH are shown in Table I. A total of 5 µl DNA Marker was used, and 1.5% agarose gel electrophoresis was performed using 5 µl RT-PCR product. GAPDH was used as an endogenous reference gene to analyze the relative gene expression levels. The thermocycling conditions were as follows: One cycle of 95°C for 3 min, followed by 35 cycles of 95°C for 5 sec, 58°C for 30 sec and 72°C for 30 sec. The expression levels were analyzed according to the 2−ΔΔCq method (20 (link)). All experiments were performed in triplicate. The appearance of a single peak in the melting curve implicated the specificity of the PCR products.
+ Open protocol
+ Expand
5

Evaluating miR-29a and TRPV4 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from GC-1 cells and testis samples using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), and the concentration of RNA was determined by a DU800 UV/Vis Spectrophotometer (Beckman Coulter, CA, USA). Total cellular RNAs were reversed transcribed into cDNA using reverse transcription reagent kit (Takara Biotechnology, Dalian China). Real-time quantitative PCR was performed via a Applied Biosystems SYBR Green mix kit and the ABI 7900 Real-Time PCR system (Applied Biosystems Life Technologies, Foster City, CA, USA). Relative miR-29a or TRPV4 mRNA expression were normalized to snRNA U6 (for miRNAs) or GAPDH (for mRNAs), respectively. The quantitative analysis was calculated by using 2−ΔΔCt method (Rao et al., 2013 (link)). The primer sequences used are shown in Table 1.
+ Open protocol
+ Expand
6

Testicular Tissue Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the testicular tissue samples from each group using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and RNA concentration was detected using spectrophotometry. First-strand cDNA was synthesized using a cDNA synthesis kit (Promega Corporation, Madison, WI, USA), following the manufacturer's protocol. Subsequently, qPCR was performed using an Applied Biosystems SYBR Green mix kit on an ABI 7900 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primer sequences for TNF-α and IL-1β were as follows: TNF-α forward, 5′-ATCCGCGACGTGGAACTG-3′, and reverse, 5′-ACCGCCTGGAGTTCTGGAA-3′; IL-1β forward, 5′-GAGCACCTTCTTTTCCTTCATCTT-3′, and reverse, 5′-TCACACACCAGCAGGTTATCATC-3′. GAPDH was used as a housekeeping gene and the primer sequences for GAPDH were as follows: Forward, 5′-ACAGCAACAGGGTGGTGGAC-3′ and reverse, 5′-TTTGAGGGTGCAGCGAACTT-3′. The data were presented as a ratio to GAPDH mRNA. qPCR was performed with 40 cycles of 94°C for 30 sec, followed by 56°C for 30 sec and 72°C for 25 sec. The quantitative analysis was conducted using the 2−ΔΔCq method (15 (link)).
+ Open protocol
+ Expand
7

Quantitative Analysis of miR-363-3p and DKK3 in PCa

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA isolation was done from the clinical specimens, as well as PCa cells with the TRIzol® reagent (Invitrogen). Afterwards, cDNA was generated from the RNA with the Takara RNA PCR kit (Takara Biotechnology). Next, qPCR was conducted on the ABI 7900 Real‐Time PCR platform by utilizing an Applied Biosystems SYBR Green mix kit (Applied Biosystems Life Technologies). Relative miR‐363‐3p or DKK3 mRNA expression was normalized to U6 (for miRNAs) or GAPDH (for mRNAs), respectively. miRNA or mRNA relative amounts of were computed with the 2−∆∆Ct approach. Oligonucleotide sequences are given in Table 1.
+ Open protocol
+ Expand
8

Quantifying NDE1 mRNA Expression in T24 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from T24 cells using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), and the RNA purity was determined using a DU800 UV/Vis Spectrophotometer (Beckman Coulter, CA, USA). Subsequently, total cellular RNAs were reversed transcribed into cDNA using a reverse transcription reagent kit (Toyobo, Osaka, Japan). Real‐time quantitative PCR was performed via an Applied Biosystems SYBR Green Mix Kit and an ABI 7900 Real‐Time PCR System (Applied Biosystems Life Technologies, Foster City, CA, USA). The expression of NDE1 mRNA was normalised to GAPDH, respectively. The relative amount of mRNA was calculated using the 2‐∆∆Ct method. The primer sequences used are shown in Table 1.
+ Open protocol
+ Expand
9

Quantitative Real-Time PCR from Kidney Cortex

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from the kidney cortex was used to synthesize cDNA using SuperScript II reverse transcriptase (Life Technologies, Carlsbad, CA). Quantitative PCR was carried out by using specific primers (Table 1). A SYBR Green Mix Kit (Applied Biosystems, Foster City, CA) and an ABI Prism 7500 Real-Time System (Applied Biosystems, Foster City, CA) were used for PCR. Relative expression levels were calculated with the 2−ΔΔCt method.
+ Open protocol
+ Expand
10

Quantitative Analysis of Apoptosis Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from the rat tissue from each group using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and the RNA concentration was obtained using a spectrophotometer. Single-stranded cDNA was synthesized using a cDNA synthesis kit (Takara, Kyoto, Japan) according to the instructions provided by the manufacturer. qPCR was performed with the Applied Biosystems SYBR Green mix kit (Applied Biosystems, Foster City, CA, USA) using the SLAN-96s Real-Time PCR system (Shanghai Hongshi Medical Technology Co., Ltd., Shanghai, China). The reaction composition contained: 2 μl cDNA, 12.5 μl 2X SYBR Green mix, 1 μl forward primer and 1 μl reverse primer and 8.5 μl ddH2O in a final volume of 25 μl. The primers used were as follows: Bax forward, 5′-TGAACTGGACAACAACATGGAG-3′, and reverse, 5′-AGCAAAGTAGAAAAGGGCAACC-3′ (GenBank accession number NM_017059); Bcl-2 forward, 5′-TTTGATTTCTCCTGGCTGTCT-3′ and reverse, 5′-CTGATTTGACCATTTGCCTG-3′ (GenBank accession number NM_016993); PARP-1 forward 5′-TCTCCAATCGCTTCTACACCCT-3′ and reverse, 5′-TACTGCTGTCATCAGACCCACC-3′ (GenBank accession number NM_013063). β-actin was used as a housekeeping gene. The data are presented as a ratio of gene to β-actin mRNA [sense: 5′-TGCTATGTTGCCCTAGAC NM_017059 TTCG-3′ and antisense: 5′-GTTGGCATAGAGGTCTTTACGG-3′ (GenBank accession number NM_031144).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!