Agarose gel dna extraction kit
The Agarose Gel DNA Extraction Kit is a laboratory tool designed for the extraction and purification of DNA fragments from agarose gels. It provides a reliable and efficient method to isolate DNA samples for further downstream applications.
Lab products found in correlation
40 protocols using agarose gel dna extraction kit
Identification and Sequencing of LbVgR Gene
Molecular Identification of Triatomine Bugs
The primers used for 16S rRNA, 28S rRNA and cytb sequence amplification
Marker | Forward primer (5’–3’) | Reverse primer (5’-3’) | Amplicon length (bp) |
---|---|---|---|
16S rRNA | CGCCTGTTTATCAAAAACAT | CTCCGGTTTGAACTCAGATCA [34 (link)] | 250 |
cytb | GGACGWGGWATTTATTATGGATC | GCWCCAATTCARGTTARTAA [32 (link)] | 250 |
28S rRNA | GCGAGTCGTGTTGCTTGATAGTGCAG | TTGGTCCGTGTTTCAAGACGGG [35 (link)] | 300 |
HIV-1 Pol Gene Amplification and Sequencing
RT-PCR Amplification of M1 and M2 Segments
Recombinant α-Amylase Expression in E. coli
DNA Ligation Kit, the MutanBEST Kit, polymerase chain reaction (PCR) reagents, restriction endonucleases, the PrimeSTAR HS DNA polymerase, and the Agarose Gel DNA Extraction Kit were purchased from TaKaRa (Dalian, China). Isopropyl β-D-1-thiogalactopyranoside and ampicillin were purchased from Sangon Biological Engineering Technology & Services Co. Ltd. All chemicals and reagents were of higher quality or analytical grade.
DENV Envelope Protein Sequencing
Cloning and Sequencing of Lymphocyte Receptors
Preparative Gel Extraction of Secondary PCR Products
PCR product extraction. Thoroughly mix 40 μL secondary PCR solutions with 8 μL 6 × loading buffer. Transfer the mixtures into preparative 1.5% agarose gel. Set the electrophoresis apparatus to voltage of 5 V/cm, with the distance of 30 cm between electrodes. Carry out electrophoresis about 25 min. Visualize DNA products via the ChemiDoc XRS+ imaging system, and cut out clear DNA bands with a knife. Extract the cut DNA bands using the Takara agarose gel DNA extraction kit. Confirmation of the extracted DNA bands with analytical agarose gel electrophoresis.
Annexin A2 Isoform 2 Cloning Protocol
Amplification of S. chuatsi GH Gene
Polymerase chain reaction (PCR) amplifications were performed in 50 μL reaction volumes containing 5 μL of 10× PCR buffer (Mg2+ Plus), 5 μL dNTPs (2.5 mM each), 2 μL of each primer (10 μM), 0.5 μL of Taq DNA polymerase (5 U/μL, TaKaRa, Dalian, China) and 1 μL of genomic DNA (50–100 ng/μL). PCR conditions were as follows: initial denaturation at 94 °C for 3 min followed by 30 cycles at 94 °C for 30 s, the optimized annealing temperature (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!