Total RNA was extracted using TRI-reagent (Sigma-Aldrich). cDNA was prepared using Moloney murine leukemia virus reverse transcriptase (Promega Corp.). RT-qPCR was performed using SYBR green ready mix (Bio-Rad) on a MX3000P RT-PCR system (Agilent Technologies) as previously described (Guo et al. 2007 (link)). The mRNA levels from RT-qPCR were calculated using the comparative Ct method (Pfaffl 2001 (link)). β-Actin was used as a calibrator for the calculation of relative mRNA levels of the tested genes. As specified in individual experiments, the mRNA levels were either expressed as fold-activation, where the values in the controls were designated as 1, or expressed as relative levels normalized to β-actin. The sequences of the primer sets utilized for RT-qPCR are listed in Table 1 .
Mx3000p rt pcr system
Manufactured by Agilent Technologies
Sourced in United States
The MX3000P RT-PCR system is a real-time PCR instrument designed for quantitative gene expression analysis. The system enables precise detection and quantification of target DNA sequences in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Tri reagent, by Merck Group (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)
Sybr green ready mix, by Bio-Rad (1 mentions)
M mlv reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Tb green premix ex taq kit, by Takara Bio (1 mentions)
4 protocols using mx3000p rt pcr system
1
Quantification of Gene Expression by RT-qPCR
2
RT-qPCR Quantification of Gene Expression
3
Duodenal mTOR Pathway Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained from the first third of the duodenum of C20D and H20D groups by phenol–chloroform extraction using Trizol. cDNA was then synthesized using 1 μg of RNA and a M-MLV reverse transcription kit (Invitrogen). Relative expression of several genes related to the mTOR pathway was assessed by qPCR (Agilent Technologies Mx3000P RT-PCR System) using the designed primers indicated in Table 3 . Data was analyzed by calculating the expression fold change via 2−ΔΔCt, and gene expression was normalized to that of two housekeeping genes (GAPDH and B2M).
Primers sequence for selected genes used in this study
| Gene | 5´to 3´ | |
|---|---|---|
| Forward | Reverse | |
| Foxo1 | AGCGTGCCCTACTTCAAGGAT | TTGTCCATGGACGCAGCTCTT |
| Mtor | TTTCCTGCGCAAGATGCTCA | AGCCTTCAGGATAGGCTCCAT |
| Eef2 | AAGGCCGCTTCTATGCCTTT | TCCACATGGCACGTCCTCAA |
| Eif4e | GCGCTTGCTTCTAGATTCCGA | AGTGCTCTGGGTTAGCAACCT |
| Skar | AAAGGCCATGGTGCCACTTCA | CCGTGGCTGCAAACTTCATCT |
| S6 | CTCTTTTTCGTGACGCCTCCCA | CACCAAGAGCATCAGCGGCTA |
| Nrf2 | CTACAGTCCCAGCAGGACATGG | GTTCCTTCTGGAGTTGCTCTTGT |
4
Quantifying Inflammatory Factor Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Inflammatory factor expression assays were performed using RT‐PCR. Total RNA was isolated from left ventricular tissue using TRIzol reagent (Sigma, USA). cDNA synthesis was performed using the PrimeScript RT Master Mix Kit (TaKaRa, China). RT‐PCR was performed using TB Green Premix Ex Taq Kit (TaKaRa) and an Mx3000p RT‐PCR system (Agilent, USA). Primers used in these experiments are listed in Table S1 (Supporting Information). The relative expression of the data was analyzed using the 2‐ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!