Ag rnaex pro rna reagent

GCs were seeded in 6-well plates and treated with dexamethasone at a concentration of 100 nmol/L for 2 h. Then, GCs were treated with control and CLOCK overexpression plasmids for 24 h. Total RNA samples were isolated using AG RNAex Pro RNA reagent (AG21101, Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China). According to a standard procedure, RNA sequencing was performed by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). RNA sequencing was completed based on Illumina. The total clean reads were mapped using NCBI Sus Scrofa RefSeq (Sscrofa 11.1). Differentially expressed genes (DEGs) were determined using DEseq2 software, and the genes with P-value < 0.05 and an absolute fold change > 1.0 were considered differentially expressed. The P-value (P < 0.05) was used to determine the significantly enriched GO terms and KEGG pathways. The information of RNA integrity number (RIN) was shown in Fig. S6. The number of reads in transcriptome sequencing was shown in Fig. S7. The raw data of transcriptome sequencing were deposited into the NCBI SRA database (BioProject ID: PRJNA944108).

Total RNA was extracted from cells and exosomes using AG RNAex Pro RNA reagent [Accurate Biotechnology (Hunan) Co., Ltd, AG21102] and reverse-transcribed to generate first-strand DNA, using miRNA first strand complementary DNA (cDNA) synthesis (tailing rReaction). Next, the synthesized cDNA was amplified using a real-time PCR system (StepOne Plus, ABI, USA) and specific primers (supplementary Table 1, see online supplementary material). Gene expression was normalized to GAPDH (internal control) and calculated using the 2^-ΔΔCT method [27 (link)].

Total RNA from GC cells and fresh tissues was extracted with AG RNAex Pro RNA reagent (Accurate Biology, CAT#AG21102, Hunan, China) according to the manufacturer's instructions. RNA was reverse transcribed to cDNA using the Evo M‐MLV reverse transcription master mix (Accurate Biology, CAT#AG11706, Hunan, China). Quantitative real-time PCR (qRT-PCR) was performing using a SYBR Green Pro Taq HS premixed qPCR kit (Accurate Biology, CAT# AG11702, Hunan, China). Primer sequences are listed in Supplementary Table S2. The 2^-ΔΔCT technique was used to analyze the data.

Several hub RNAs were identified by LASSO analysis. The expression of these hub RNAs was detected by qPCR. Total RNA was extracted from the gastric tissues and cell lines (including GES1 cells, MKN45 cells, NFs and CAFs) with the AG RNAex Pro RNA reagent (Accurate Biology, CAT#AG21102) following the manufacturer’s instructions. cDNA was synthesized using Evo M-MLV reverse transcription master mix (Accurate Biology, CAT# AG11706). qPCR was conducted utilizing a SYBR Green Pro Tag HS premixed qPCR kit (Accurate Biology, CAT# AG11701). The relative expression of the hub RNAs was calculated using the 2^–ΔΔCt method. mRNA expression was normalized to β-actin. The primer sequences of all RNAs used for qPCR are recorded in Table S1.

Following the manufacturer's instructions, AG RNAex Pro RNA reagent (Accurate Biology, CAT#AG21102) was used to extract total RNA from tissue samples or cell lines. Evo M‐MLV reverse transcription master mix (Accurate Biology, CAT#AG11706) was used to synthesize cDNA from 2 μg RNA of each sample. SYBR Green Pro Taq HS premixed qPCR kit (Accurate Biology, CAT# AG11701) was used for qRT‐PCR. METTL16 primer sequence: forward, 5'‐CTCTGACGTGTACTCTCCTAAGG‐3' and reverse, 5'‐TACCAGCCATTCAAGGTTGCT‐3'. GAPDH: forward, 5'‐GGAGCGAGATCCCTCCAAAAT‐3' and reverse, 5'‐GGCTGTTGTCATACTTCTCATGG‐3'. CDK2: forward, 5'‐CCAGGAGTTACTTCTATGCCTGA‐3' and reverse, 5'‐TTCATCCAGGGGAGGTACAAC‐3'. CDK6: forward, 5'‐GCTGACCAGCAGTACGAATG‐3'and reverse, 5'‐GCACACATCAAACAACCTGACC‐3'. cyclin D1: forward, 5'‐GCTGCGAAGTGGAAACCATC‐3' and reverse, 5'‐CCTCCTTCTGCACACATTTGAA‐3'. cyclin E1: forward, 5'‐AAGGAGCGGGACACCATGA‐3' and reverse, 5'‐ACGGTCACGTTTGCCTTCC‐3'. Each sample had 3 repeated tests. Data were analysed via the 2^−ΔΔCT calculation method.