Multigene primer mix (1 μM) was prepared by adding the following components to a nuclease-free (NF) 0.2-mL centrifuge tube: 1 μL of 100 μM forward gene primer, 1 μL of 100 μM reverse gene primer, and NF water up to 100 μL. cDNA template (10 μL) generated from single cells was preamplified in a total volume of 20 μL containing 1× PCRBIO Ultra Mix (PCR Biosystems), 100 nM of each primer, and NF water. The following thermal setting was applied on the PCR cycler: 95 °C for 10 min followed by 25 cycles of amplification (95 °C for 20 s, 60 °C for 1 min, and 72 °C for 20 s) and a final additional incubation at 72 °C for 7 min. Amplified target amplicons were purified before being subjected to purification using Agencourt AMpure XP beads at a 1:1.5 ratio following the manufacturer’s manual (Beckman Coulter), with the final elution in 60 μL of NF water before quantification.
Pcrbio ultra mix
Manufactured by PCR Biosystems
Sourced in United States
PCRBIO Ultra mix is a high-performance, ready-to-use PCR master mix for sensitive and reliable amplification of DNA and RNA targets. It contains a robust DNA polymerase, optimized buffer system, and enhancers for efficient and consistent results.
Automatically generated - may contain errors
Lab products found in correlation
Tapestation 2200, by Agilent Technologies (2 mentions)
Agencourt ampure xp bead, by Beckman Coulter (2 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions)
D1000 high sensitivity d1000 screen tapes, by Agilent Technologies (2 mentions)
Nuclease free water, by Qiagen (2 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Miseq platform, by Illumina (1 mentions)
4 protocols using pcrbio ultra mix
1
Multiplex qPCR Amplification and Purification
2
Bacterial 16S V1-V3 rRNA Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial 16S V1-V3 rRNA gene sequencing libraries were prepared by a custom protocol based on (Caporaso et al., 2012) [44 (link)]. Up to 10 ng of extracted DNA was used as template for PCR amplification of the bacterial 16S V1-V3 rRNA gene amplicons. Each PCR reaction (25 μL) contained (12.5 μL) PCRBIO Ultra mix (PCR Biosystems, Wayne, PA, USA) and 400 nM of each forward and reverse tailed primer mix. PCR was conducted with the following program: Initial denaturation at 95 °C for 2 min, 30 cycles of amplification (95 °C for 15 s, 55 °C for 15 s, 72 °C for 50 s) and a final elongation at 72 °C for 5 min. Duplicate PCR reactions were performed for each sample and the duplicates were pooled aft er PCR. The adaptors contain 16S V1-V3 specific primers: [27F] AGAGTTTGATCCTGGCTCAG and [534R] ATTACCGCGGCTGCTGG [45 (link)]. The resulting amplicon libraries were purified using the standard protocol for Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA, USA) with a bead to sample ratio of 4:5. DNA was eluted in 25 μL of nuclease free water (Qiagen, Hilden, Germany). DNA concentration was measured using Qubit dsDNA HS Assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Gel electrophoresis using TapeStation 2200 and D1000/High sensitivity D1000 screen tapes (Agilent technologies, Santa Clara, CA, USA) was used to validate product size and purity of a subset of sequencing libraries.
3
16S rRNA Gene Sequencing of Prokaryotic Community
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An aliquot of the purified genomic DNA was submitted to the Functional Genomics Center of the Luiz de Queiroz College of Agriculture (ESALQ-USP) to perform 16S rRNA gene sequencing. Briefly, the V4-region of the 16S rRNA gene, targeting the prokaryotic community, was amplified with the primer pair 515F92 (link) and 806R93 (link). The reaction mixture (25 μL) encompassed of 2.5 µL of template DNA (20 ng μl-1), 0.20 mM of each primer, 2X PCRBio Ultra Mix (PCRBiosystems, Wayne, USA). The thermal cycle started with 3 min at 95 °C, followed by 30 cycles of 30 s at 95 °C, 30 s at 60 °C and 30 s at 72 °C. A final extension of 10 min at 72 °C was applied for reaction completion. The amplicons were subjected to Illumina sequencing using MiSeq platform.
4
16S rRNA Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacteria 16S V1-3 rRNA gene sequencing libraries were prepared using a custom protocol based on Caporaso et al. (2012) [34 (link)]. Up to 10 ng of extracted DNA was used as a template for PCR amplification of the bacterial 16S V1-V3 rRNA gene amplicons. Each PCR reaction (25 μL) contained (12.5 μL) PCRBIO Ultra mix (PCR Biosystems, London, United Kingdom) and 400 nM of each forward- and reverse-tailed primer mix. PCR was conducted with the following program: Initial denaturation at 95 °C for 2 min, 30 cycles of amplification (95 °C for 15 s, 55 °C for 15 s, 72 °C for 50 s) and a final elongation at 72 °C for 5 min. Duplicate PCR reactions were performed for each sample and the duplicates were pooled after PCR. The adaptors contained 16S V1-V3 specific primers: [27F] AGAGTTTGATCCTGGCTCAG and [534R] ATTACCGCGGCTGCTGG. The resulting amplicon libraries were purified using the standard protocol for Agencourt Ampure XP Beads (Beckman Coulter, San Diego, CA, USA) with a bead-to-sample ratio of 4:5. DNA was eluted in 25 μL of nuclease-free water (Qiagen, Hilden, Germany). DNA concentration was measured using a Qubit dsDNA HS Assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Gel electrophoresis using TapeStation 2200 and D1000/High-sensitivity D1000 screen tapes (Agilent, Santa Clara, CA, USA) was used to validate the product size and purity of a subset of sequencing libraries.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!