Psuper retro puro

Retroviral-mediated stable expression of IFI6 was achieved by using EA.hy926 cells and the pBabe-Puro Retroviral Vector system (pBabe; Addgene, Cambridge, MA, USA) or the pSUPER RNAi system (pSUPER.retro.puro, pSUPERretro; Addgene) to over-express or knock-down gene expression, respectively.
The over-expression primers were: forward, 5’-CGGAATTCATGCGGCAGAAGGCGGTATC-3’ and reverse, 5’-GAAGATCTCTACTCCTCATCCTCCTCACTAT-3’. The knock-down primers were: forward, 5’-GAGAATGCGGGTAAGGATGCATTCAAGAG-A-3’ and reverse, 5’-GAGAATGCGGGTAAGGATGCATCTCTTGAA-3’. The over-expressed plasmid was named pMSCV-neo-IFI6⁺ with the corresponding vector named vector-high. The knock-down plasmid was named pSUPERretro-IFI6^- with the corresponding vector named vector-low. The plasmids were constructed, and then transfected into EA.hy926 cells as described previously [19 (link)].

lentiCRISPR v2, pCMV-VSV-G, psPAX, pcDNA3-myc-Skp2, CMV10-3xFlag Skp2 delta-F, pSuper-retro-puro, HA-Ubiquitin, pRK5-HA-Ubiquitin-K48R and pET3a-Ubiquitin-K63R plasmids were purchased from Addgene, Flag–His-SKP2, Flag-His-ΔN-SKP2, Flag-His-PDCD4 and Flag-His-PDCD4(Ser67)plasmids were purchased from Biosune Biotechnology. The sgRNA and shRNA sequences for SKP2 were as follows: sgSKP2:AGAATCCAGAACACCCAGAA; shSKP2:GATCCCCGCCTAAGCTAAATCGAGAGAATTCAAGAGATTCTCTCGATTTAGCTTAGGCTTTTTGGAAA. shRNA sequences for PDCD4 were as follows: CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG.