Anti beta actin antibody

We used pSilencer 3.1-H1 (Life Technologies) as an shRNA vector. The sequences of the shRNA duplexes used RARα knockdown were as follows: RARα gene, sense 5′- GCAAGTACACTACGAACAACATTCAAGAGATGTTGTTCGTAGTGTACTTGCTTTTTTGGAA-3′ and antisense 5′- TTCCAAAAAAGCAAGTACACTACGAACAACATCTCTTGAATGTTGTTCGTAGTGTACTTGC-3′, no-target as a control, sense 5′-GTACTATTCGACACGCGAAGTTCAAGAGACTTCGCGTGTCGAATAGTACTTTTTTGGAA-3′ and antisense 5′-TTCCAAAAAAGTACTATTCGACACGCGAAGTCTCTTGAACTTCGCGTGTCGAATAGTAC-3′. Lipofectamine 2000 was used to transfect with each of these constructs into P19 cells. Western blotting probed with an anti-RARα antibody (Santa Cruz Biotechnology, CA) and anti-Beta-Actin antibody (Thermo SCIENTIFIC, CA) were performed to assess RARα knockdown. The influence of Tal2 expression by RARα suppression was examined by real-time PCR.

Cells were lysed in TNET buffer (50 mM Tris-HCl, 100 mM NaCl, 5 mM EDTA, and 1% TritonX-100, pH 7.5) containing protease and phosphatase inhibitors (1 g/ml leupeptin, 1 g/ml pepstatin, 2 M PMSF, 2 g/ml aprotinin, 2.5 M sodium pyrophosphate, 1 M sodium fluoride, and 1 M sodium orthovanadate). Protein concentrations were determined with a BCA Protein Assay kit (Pierce). Homogenized samples were mixed with protein loading buffer and 2-mercaptoethanol (final concentration 5%) and boiled for 5 min. Equal amounts of samples were separated by 7.5% SDS-PAGE and subjected to immune blot analysis. The anti-beta-actin antibody was obtained from Thermo Scientific, the anti-histidine-tag (His-tag) from Serotec, and the anti-myc from Sigma Aldrich.