E coli bl21
E. coli BL21 is a common bacterial strain used in molecular biology and protein expression. It is a widely used host strain for the production of recombinant proteins. E. coli BL21 is characterized by its ability to efficiently express proteins from introduced DNA sequences.
Lab products found in correlation
26 protocols using e coli bl21
Bacterial Culture and Protein Expression
Expression and Purification of AGR2 Proteins
TET8-specific Peptide Antibody Production
Bacterial Culture and Cell Line Maintenance
Effect of Bacterial Isolates on Oral Keratinocyte Viability
Fab Protein Expression and Purification in E. coli
Protein-Protein Interaction Detection via GST Pull-Down Assay
TET8-specific Peptide Antibody Production
Purification and Biotinylation of Talin R3-IVVI Domain
Synthetic Bioproduction of DODA Enzyme
PCR amplification was performed using Taq DNA polymerase and the following primers: AcDODA‐F (5´ TGGGGACATATGAAAAGCAAAAC) and AcDODA‐R (5´ GCTGCAGATCTCGAGTTACAGAC). This amplification yielded a 384 bp product, which coincides with the entire DODA synthetic gene plus the additional 6 His‐tag sequence. The plasmid pRSETA‐AcDODA was subsequently used in further experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!