Taqman fast universal pcr master mix

The total urine pellet RNA was isolated using the manufacturer protocol (RNeasy Mini Kit; Qiagen—Germantown, MD). Quantitation of the absolute nephrin and podocin, mRNA abundance was performed using the CFX96 Touch™ Real-Time PCR Detection System (Bio-rad, USA) using TaqMan Fast Universal PCR Master Mix, with sample cDNA in a final volume of 25 μl per reaction. TaqMan Probes (Applied Biosystems) used were as follows: human NPHS1 (nephrin gene accession number: Q1KMS5) and NPHS2 (podocin gene accession number: Q9NP85). All data were from 2-μl sample measured in duplicate. Standard curves were constructed for each assay using serially diluted cDNA standards. Assays were accepted only if the r2 > 0.97 for standard curves. Human nephrin and podocin cDNA of known sequence and concentration were used as standards for each assay so that the data could be calculated on number of copy basis for each probe. RNA urine analysis quality, recovery, and stability were performed.
Samples were coded and analyzed with the laboratory operator blinded to the visit number, the subject it belonged to, or whether this subject eventually developed CVD or not.

Total RNA was isolated from cells using the PureLink RNA Mini Kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. The mRNA reverse transcription was conducted using the iScript cDNA synthesis kit (Bio‐Rad Laboratories, Hercules, CA, USA), or the mature miR reverse transcription was accomplished using the TaqMan miR Reverse Transcription Kit (Applied Biosystems, Inc., Foster City, CA, USA). ABI StepOne Real‐Time PCR System (Applied Biosystems) and SYBR Green Mix (Bio‐Rad) were utilized for mRNA expression, or TaqMan Universal Fast PCR Master Mix for miRNA expression. Relative mRNA and miRNA expression was examined using the 2^−∆∆Cq method and normalized to the levels of glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) and U6, respectively. The primers were synthesized by Sangon (Shanghai, China): miR‐125a, forward 5′‐CGGTCCCTGAGACCCTTTAAC‐3′, reverse 5′‐GTGCAGGGTCCGAGGT‐3′; HDAC2, forward 5′‐TAAATCCAAGGACAACAGTGG‐3′, reverse 5′‐GGTGAGACTGTCAAATTCAGG‐3′; PHOX2B forward 5′‐AGTGGCTTCCAGTATAACCCG‐3′, reverse 5′‐GGTCCGTGAAGAGTTTGTAAGG‐3′; MYCN forward 5′‐ACCCGGACGAAGATGACTTCT‐3′, reverse 5′‐CAGCTCGTTCTCAAGCAGCAT‐3′; U6 forward 5′‐CTCGCTTCGGCAGCACA‐3′, reverse 5′‐AACGCTTCACGAATTTGCGT‐3′; and GAPDH forward 5′‐GATTCCACCCATGGCHDAC2TTC‐3′, reverse 5′‐AGCATCGCCCCACTTGATT‐3′.