Glycerol stocks of lentiviral shRNA targeting LDLR were obtained from Sigma-Aldrich (St. Louis, MO). shRNA sequences were: control shRNA: CAACAAGATGAAGAGCACCAA, and LDLR shRNA human (H1) GATGAAGTTGGCTGCGTTAAT, human (H2) GGGCGACAGATGCGAAAGAAA, mouse (M1) AGTCGCCATTCTCCCTTAATA, mouse (M2) ACGGGTTCAGATGTGAATTTG. Plasmid DNA generation, HEK293FT transfection, and target cell lentiviral transduction were performed as previously described [48 (link)]. After the transduction, puromycin was used for selection of stable knockdown of the LDLR in the tumor cells. LDLR protein reduction was confirmed by Western Blot analysis.
Glycerol stocks of lentiviral shrna targeting
Manufactured by Merck Group
Glycerol stocks of lentiviral shRNA targeting are a laboratory tool used to store and maintain shRNA (short hairpin RNA) sequences delivered via lentiviral vectors. These stocks provide a concentrated source of the lentiviral particles containing the specific shRNA constructs, which can be used for gene knockdown experiments.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using glycerol stocks of lentiviral shrna targeting
1
LDLR Knockdown in Tumor Cells
2
LDLR Knockdown in Tumor Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!