Nucleic acids were extracted from whole peripheral blood samples using QIAmp DNA Blood Mini Kit (QIAGEN) or MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche) following the manufacturer’s instructions. CYP3A5, MRP2, and UGT1A9 were selected as genes with variants of interest for this study, because they have been proposed as the major factors to explain the variability related to plasma drug levels (TAC and MPA) and have shown similar results in different populations. The presence of the CYP3A5 c. A6986G polymorphism (rs776746) was determined using the PCR-RFLP technique with specific primers (forward 5′-CAT GAC TTA GTA GAC AGA TGA-3 ′and reverse 5′-GGT CCA AAC AGG GAA GAA ATA-3′) and the restriction enzyme SspI, according to previously described protocols (Rong et al., 2010 (link)). The assessment of the polymorphisms UGT1A9 2152C > T (rs17868320), UGT1A9 -275T > A (rs6714486) and MRP2 -24C > T (rs717620) was performed with the TaqMan™ Drug Metabolism Genotyping Assay (ThermoFisher). All SNPs were processed on LightCycler® 480II and analyzed with the LightCycler® 480II software (Roche). Each assay included controls confirmed previously by Sanger sequencing for the three genotypes (homozygous reference allele, heterozygous, homozygous variant allele) if available and negative controls with an equal volume of nuclease-free pure water.
Lightcycler 480 2 software
Manufactured by Roche
Sourced in Switzerland
The LightCycler 480 II software is a comprehensive software solution for real-time PCR data analysis. It provides various tools for experimental setup, data acquisition, and result interpretation. The software supports a range of detection chemistries and enables users to perform diverse real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Path id multiplex one step rt pcr kit, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480 probes master kit, by Roche (2 mentions)
μmacs mrna isolation kit, by Miltenyi Biotec (2 mentions)
Ovation picosl wta system v2 kit, by Tecan (2 mentions)
Bioanalyzer 2100 system, by Qiagen (2 mentions)
Minelute reaction cleanup kit, by Qiagen (2 mentions)
Lightcycler 480 instrument 2, by Roche (2 mentions)
Taqman probe, by Roche (2 mentions)
Taqman drug metabolism genotyping assay, by Thermo Fisher Scientific (1 mentions)
Magna pure compact nucleic acid isolation kit 1, by Roche (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Qiamp dna blood mini kit, by Qiagen (1 mentions)
High pure rna isolation kit, by Roche (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (1 mentions)
M mlv rt, by Promega (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Gel extraction kit, by Thermo Fisher Scientific (1 mentions)
Generuler 100 bp dna ladder, by Thermo Fisher Scientific (1 mentions)
9 protocols using lightcycler 480 2 software
1
Pharmacogenetic Biomarkers for Immunosuppressants
2
Quantitative RT-PCR Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from analyzed cells was extracted with a High pure RNA isolation kit (Roche 11828665001) according to the manufacturer’s instructions. RNA concentration and purity were determined using a NanoDrop-1000 spectrophotometer (Thermo Scientific). Total RNA (200–500 ng) was reverse transcribed using the Transcriptor first strand cDNA synthesis kit (Roche; 04897030001) according to the manufacturer’s instructions. Equal volumes of cDNA reaction were added to the Real-time PCR reactions. Target cDNA levels were analyzed by the comparative cycle time (Ct) method of Real-time quantitative RT–PCR with 20 μl reactions performed with LightCycler 480 SYBR Green I Master Mix (Roche; 04707516 001) and gene specific primers (Oct4 F:AAGCGATCAAGCAGCGACTAT, R:GGAAAGGGACCGAGGAGTACA, Nanog F: CAAAGGCAAACAACCCACTT, R: TCTGCTGGAGGCTGAGGTAT and GAPDH F:TCATTTCCTGGTATGACAACG, R:ATGTGGGCCATGAGGT). Triplicate assays were carried out and the mean relative level of expression and associated standard deviations were calculated using advanced relative quantification method in Lightcycler 480 II software (Roche).
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using standard methods. mRNA levels were analysed by real-time PCR (RT-PCR) with TaqMan primerprobe sets using the Path-ID Multiplex One-Step RT-PCR kit (Path-ID™ Multiplex One-Step RT-PCR Kit, Applied Biosystems, Foster City, CA, USA). The reference transcript (ACTB or TBP or G6PD) was used as an internal standard and was amplified together with each target gene transcript in the same well using primers and probes (Table SI 1 ).
The level of each analysed transcript was normalized to that of the appropriate reference transcript. Data analysis was performed using LightCycler 480 II software (Roche Diagnostics International Ltd, Rotkreuz, Switzerland).
The level of each analysed transcript was normalized to that of the appropriate reference transcript. Data analysis was performed using LightCycler 480 II software (Roche Diagnostics International Ltd, Rotkreuz, Switzerland).
4
Nucleofection of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sigma-Aldrich and sequences are listed in supplementary table 1. Vectors coding for GFP and GFP-fused Rac V12 were provided by Dr. Francisco Sánchez-Madrid (Hospital de la Princesa, Madrid, Spain). siRNAs and vectors were nucleofected (Amaxa, Cologne, Germany) using solution V and programs T-01, O-23 and T-13 for NCI-H929, MM1.S and MEC-1 cells, respectively, and transfectants assayed 20 h (NCI-H929) or 20-72 h (MEC-1) post-transfection. For RT-qPCR, RNA was extracted using TRI-Reagent (Sigma-Aldrich), and reverse transcribed using M-MLV RT (Promega, Madison, WI). Oligonucleotide sequences are provided in supplementary table 2, and RT-qPCR was performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA). Assays were performed in triplicate, and results normalized according to the expression levels of TBP (TATA-binding protein) RNA and expressed by using the LightCycler 480 II software (Roche).
5
Quantitative PCR Standardization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was done using the standard curve method. For this purpose, the desired sequences for analyzed genes were amplified by PCR and visualized on 1.5% agarose gel with the Gene RulerTM 100 bp DNA Ladder (Fermentas, Burlington, ON, Canada). The PCR product was extracted from the gel, isolated and purified using the Gel Extraction Kit (Fermentas, Burlington, ON, Canada). Based on the DNA concentration measured with a Nanodrop c2000 system (Thermo Scientific, Carlsbad, CA, USA), a serial 10-fold dilutions of a DNA with a known concentration (standards) were generated. Each standard was used as a separate template for a real-time PCR reaction to produce the appropriate standard curve with the LightCycler 480 II software (Roche, Basel, Switzerland). The reaction conditions and the efficiency of the reactions for all genes were analyzed separately. All reactions were performed using the Light Cycler 480 II system with a set of supplied reagents. The 10 μL reaction mixture consisted of 5 μL of the LightCycler Probe Master, 0.5 μM primers, 0.3 μM probes and 1 μL each of the cDNA. The reaction conditions were as follows: denaturation: 95 °C, 10 min; amplification: 40 cycles of 95 °C for 10 s, 60 °C for 10 s, 72 °C for 10 s; and final cooling at 40 °C. The temperature slope was set at 20 °C/s during amplification.
6
Gene Expression Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FLG, FLG2, RPTN, HRNR, LELP-1, SPRR 1A, SPRR1B, SPRR3, LOR and HRNR mRNA levels were analyzed by real-time PCR (RT-PCR) with TaqMan primer–probe sets using the Path-ID Multiplex One-Step RT-PCR kit (Path-ID Multiplex One-Step RT-PCR kit, Applied Biosystems, Foster City, CA, USA). The reference transcript (ACTB or TBP or G6PD) was used as an internal standard and was amplified together with each target gene transcript in the same way using primers and probes (Table 1 ). Data analysis was performed using LightCycler 480 II software (Roche Diagnostics International Ltd., Rotkreuz, Switzerland).
7
Quantification of miRNA-142-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA (1 µg) was reverse-transcribed using the Mir-X™ miRNA First-Strand Synthesis kit (Clontech Laboratories, Inc., Mountain View, CA, USA) to generate cDNA. The LightCycler® 480 SYBR-Green I Master (Roche Diagnostics, Inc., Indianapolis, IN, USA) was used for the RT-qPCR procedure, according to the manufacturer's protocol to quantify the miRNA transcript levels. The appropriate quantification cycle (Cq) value was determined using the automatic baseline determination feature. The reaction solution contained 10 µl 2X Master Mix, 1 µl miR-specific primer for human miR-142-3p, 1 µl universal primer, cDNA (100 ng) and nuclease-free water to a total volume of 20 µl. The sequence of the hsa-miR-142-3p primer was as follows: 5′-TGTAGTTTCCTACTTTATGGA-3′. U6 was used for miRNA level normalization. The U6 primer was as follows: Forward, 5′-CCUCGUGCCGUUCCAGGUAGUU-3′ and reverse, 5′-CUACCUGAUGAACGGCAGGUU-3′. DNA was amplified using 45 cycles of denaturation for 10 sec at 95°C and annealing for 10 sec at 60°C. Each sample was assessed in triplicate. The relative expression of the miRNA was quantified using Lightcycler® 480 II software (Roche Diagnostics Inc., Indianapolis, IN, USA) and the 2−ΔΔCq method (27 (link)).
8
mRNA Expression Analysis of Leukocyte Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was isolated from unstimulated and stimulated leukocytes using the μMACS mRNA Isolation kit (Miltenyi Biotec, Auburn, CA) and then amplified using the Ovation PicoSL WTA System V2 kit according to the manufacturer’s instructions (NuGEN Technologies, Inc, San Carlos, CA). Amplified cDNA was purified with the MinElute Reaction Cleanup kit (Qiagen) and quality and quantity analyzed using a Bioanalyzer 2100 system (Qiagen, Valencia, CA; Agilent, Wilmington, DE). cDNA from unstimulated and stimulated samples was quantified for 12 target genes in 8 separate panels by qPCR using TaqMan probes (TIB Molbiol LLC, Adelphia, NJ) and the LightCycler 480 Probes Master kit on the LightCycler 480 Instrument II (Roche Diagnostics, Indianapolis, IN). Transcription factor mRNA (RORC, TBET, GATA3 and FOXP3) were analyzed only in the unstimulated fraction, while the remaining target mRNA (CD3, IFN-γ, IL-5, IL-2, IL-4, IL-6 and TNF-α) were analyzed for both unstimulated and stimulated fractions to measure activation. Ubiquitin ligase (UBE2D2) mRNA expression was used for housekeeping. Primer and TaqMan probe information is given in Supplementary Table S1 online . TaqMan probes were used in either monoplex or duplex reactions; for duplex reactions, color compensation was performed using LightCycler 480 II software according to the manufacturer’s instructions (Roche Diagnostics, Indianapolis, IN).
9
mRNA Expression Analysis of Leukocyte Activation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!