Oligonucleotides, including miR-1323 mimics, miR-1323 inhibitor, TP53INP1 siRNA, GAS5 siRNA and NC Oligonucleotides, were obtained from GenePharma (Shanghai, China). TP53INP1 3′-UTR and GAS5 sequences including putative miR-1323 binding sites were fused to a modified pcDNA3.1 vector containing sequences encoding a luciferase reporter gene. Reporter plasmids with mutant sites were constructed using Mutagenesis Kit (Stratagene, La Jolla, CA, USA). Oligonucleotides and plasmids were transfected using Hiperfect transfection reagent (Qiagen, Valencia, CA, USA) and Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA), respectively. Luciferase reporter analysis was conducted using Dual Luciferase Assay System (Promega, Madison, WI, USA) according to the manufacturer’s instructions.
Gas5 sirna
Manufactured by GenePharma
Sourced in China
GAS5 siRNA is a laboratory reagent designed for gene silencing experiments. It is a synthetic small interfering RNA (siRNA) molecule that targets the GAS5 gene, which is involved in various cellular processes. The GAS5 siRNA can be used to temporarily reduce the expression of the GAS5 gene in cell culture studies, allowing researchers to investigate the gene's role and function.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase assay system, by Promega (1 mentions)
Hiperfect transfection reagent, by Qiagen (1 mentions)
Nc oligonucleotides, by GenePharma (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Tp53inp1 sirna, by GenePharma (1 mentions)
Control sirna, by GenePharma (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Mir 21 mimic, by GenePharma (1 mentions)
Mir 21 inhibitor, by GenePharma (1 mentions)
2 protocols using gas5 sirna
1
Investigating miR-1323 Regulatory Interactions
2
miRNA and siRNA Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRNAs including miR‐21 mimics, the corresponding mimics negative control and miR‐21 inhibitor were purchased from GenePharma. GAS5 siRNA (forward: 5’‐CACUCUGAGUGGGACAAGCUCUUCA−3’ and reserve: 5’‐UGAAG AGCUUGUCCCACUCAGAGUG−3’) and control siRNA (forward: 5’‐CACGAGUG GGUAACACUCGUCUUCA−3’ and reserve: 5’‐UGAAGACGAGUGUUACCCA CU CGUG‐3’) were synthesized from GenePharma. After 24 h incubation, the cells were transfected with siRNA and miRNA using lipofectamine 3000 (Invitrogen, Carlsbad, CA), respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!