Fx96 cycler

Basal mRNA expression was analyzed in neutrophils or PBMC after isolation. Interferon-induced genes were analyzed upon IFNα or IFNγ stimulation of neutrophils for 4 h. RNA isolation, reverse transcription and RT-PCR were performed according to a previously published protocol [19 (link)]. TaqMan primer/probe sets were used (Thermo Fisher Scientific). The sample data were matched to a standard curve generated by amplifying serially diluted products using the same PCR and normalized to GAPDH (Thermo Fisher) to obtain the relative expression value. Real-time assays were run on an FX96 cycler (Bio-Rad, San Diego, CA, USA).

Total RNA was isolated using the RNeasy Mini kit following the manufacturer’s instructions (Qiagen, Hilden, Germany). RNA quality and quantification were determined by TapeStation 4200 (Agilent, St. Clara, USA) following the manufacturer’s instructions. Neutrophil total RNA was isolated using RNeasy Mini kit following the manufacturer’s instructions (Qiagen), and complementary DNA (cDNA) was synthesized using M-MLV Reverse Transcriptase (Thermo Fisher Scientific). RT-PCR was performed in duplicates using the cDNA and Platinum Taq polymerase (Thermo Fisher Scientific), 200 nM dNTP (Promega, Southampton, UK), 50mM MgCl₂ (Thermo Fisher Scientific), and TaqMan primer/probe sets (Thermo Fisher Scientific). Samples were matched to a standard curve generated by amplifying serially diluted products using the same PCR reaction and normalized to GAPDH (Hs00266705_g1) to obtain the relative expression value. Real-time assays were run on FX96 Cycler (Bio-Rad). The following are the primes used: STAT1 (Hs01013996_m1), STAT2 (Hs01013115_g1), STAT3 (Hs00374280_m1), IFIH1 (Hs00223420_m1), IFIT (Hs00356631_g1), ISG15 (Hs00192713_m1), MX1 (Hs00895608_m1), IRF1 (Hs00971965_m1), SOCS1 (Hs00705164_s1), USP18 (Hs00276441_m1), IFI44 (Hs00197427_m1), IFI16 (Hs00986757_m1), and OAS (Hs00242943_m1) (all from Thermo Fisher Scientific).

PBMCs were stimulated for 5 hours with rhIL-27 (100 ng/ml) or left untreated. RNA isolation, reverse transcription and RT-PCR were performed according to a previously published protocol^{35 (link)}. Total RNA was isolated using the RNeasy Mini Kit following the manufacturer’s instructions (Qiagen, MD, USA), and complementary DNA (cDNA) was synthetized using M-MLV Reverse Transcriptase (ThermoFisher Scientific). RT-PCR was performed in duplicate using the obtained cDNA and Platinum Taq polymerase (ThermoFisher Scientific), 200 nM dNTP (Promega, Southampton, UK), 50 mM MgCl₂ (ThermoFisher Scientific) and TaqMan primer/probe sets (ThermoFisher Scientific). Samples were matched to a standard curve generated by amplifying serially diluted products using the same PCR and normalized to GAPDH (forward primer GAAGGTGAAGGTCGGAGTC; reverse primer GAAGATGGTGATGGGATTTC; FAM/TAMRA CAAGCTTCCCGTTCTCAGCC) (TIB MOLBIOL, Berlin, Germany) to obtain the relative expression value. Real-time assays were run on an FX96 Cycler (Bio-Rad). The following primer/probe sets were used: IL-27Ralpha (Hs00956025_m1), CXCL10 (Hs00171042_m1), SOCS3 (Hs02330328_s1), PD-L1 (Hs01125301_m1), PD-L2 (Hs00228836_m1), PD-1 (Hs00169472_m1), all from ThermoFisher Scientific.