The largest database of trusted experimental protocols

2 protocols using anti rabbit igg h l sa00001 2

1

Signaling Pathways Modulated by MRGPRX2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fetal bovine serum (FBS) used was the Gibco (Grand Island, NY) product. Compound 48/80 (C48/80), poly-d-lysine hydrobromide (PDL) and p-nitrophenyl-N-acetyl-β-d-glucosaminide were the Sigma Aldrich (Saint Louis, MO) products. Triton X-100 was procured from Amresco (Solon, OH). Liquiritin was procured from Yuanye Biotechnology (Shanghai, China). Penicillin, streptomycin, Fluo-4 AM and RIPA lysis buffer were obtained from Beyotime Biotechnology (Shanghai, China). TNF-α and histamine ELISA kits were procured from Meimian Industrial (Yancheng, China). A plasmid with MRGPRX2 was constructed by GENERAL BIOL (Anhui, China). Anti-TNF-α antibody (ab205587) was the product of Abcam (Cambridge, England). Lipofectamine 2000 and Opti-MEM were the Invitrogen (Carlsbad, CA) products. Monoclonal GAPDH antibody (60004-1-Ig), HRP-conjugated Affinipure Goat Anti-Mouse IgG (H + L) (SA00001-1) and Anti-Rabbit IgG (H + L) (SA00001-2) were procured from Proteintech (Wuhan, China).
+ Open protocol
+ Expand
2

Plasmid Construction for 100K and HSC70

Check if the same lab product or an alternative is used in the 5 most similar protocols
For plasmids construction, 100K and HSC70 were amplified by using genome DNA of rCH/HNJZ/2015-△1966/EGFP and cDNA of LMH cells as templates with specific primers shown in Table 1, respectively. The amplicons were subsequently cloned into linearized pCAGGS-N-HA and pCMV-3 × flag, respectively, to generate pCAGGS-N-HA-100K and pCMV-3 × flag-HSC70. Mouse anti-HA monoclonal antibody (66006-2-Ig), rabbit anti-flag polyclonal antibody (20543-1-AP), and mouse anti-actin monoclonal antibody (66009-1-Ig) were obtained from Proteintech (Wuhan, China). Mouse anti-chicken HSC70 antibody (LS-C108953) was purchased from LSBio (Seattle, WA). HRP-conjugated goat anti-mouse IgG(H+L) (SA00001-1) and anti-rabbit IgG(H+L) (SA00001-2) antibodies were purchased from Proteintech.

Primers for 100K and HSC70 cloning.

Table 1
PrimersSequence (5’-3’) *
pCAGGS-N-HA-FAGCGTAATCTGGAACATCGTATG
pCAGGS-N-HA-RTTAAGGATCTTTTTCCCTCTGCC
FAdV4-100K-Fcagattacgct ATGTCGAATCCGTCGGT
FAdV4-100K-RaaagatccttaaTTACCTCGGGGTGCTCG
pCMV-3 × flag-FCGGGTGGCATCCCTGTGACC
pCMV-3 × flag-RCTTGTCATCGTCATCCTTGTAATCG
HSC70-FgatgacaagTCAAAGGGACCAGCTGTTG
HSC70-RTgccacccgTTAATCCACCTCCTCAATGGTTG

Lower case letters represent the homologous arms.

+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!