Quantitect reverse transcription kit

Total RNA extraction from mouse back skin was performed with the miRNeasy Mini Kit (Qiagen, Manchester, UK) and RNA was reverse transcribed by QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. MSC were licensed as previously described, or left as unlicensed controls, and then were harvested as above. Supernatants were frozen at −80 °C for Luminex analysis of protein expression (see below). Shortly, RNA extraction was performed with the RNeasy Mini Kit (Qiagen) and RNA was reverse transcribed by QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. In both cases, pairs of primers were designed (detailed in Table S2) to relatively quantify the amount of specific cDNA in a sample by SYBR Green (QuantaBio). The quantitative reverse transcription PCR assay was performed using the Applied Biosystems 7900HC Fast Real-Time PCR Systems detection system (Applied Biosystems, Paisley, UK).
Samples were analyzed using TBP as a reference for data normalization and data were represented as 2^(−ΔΔCT).

The expression of NLRP3 gene was analyzed by SYBR Green quantitative PCR of mRNA extracted from cardiac tissues. Total cellular RNA was purified from the cells using the Trisure method (Bioline, London, UK). RNA concentration was determined spectrophotometrically. Contaminating genomic DNA was removed by incubation of one microgram of total RNA from each sample with gDNA wipeout buffer (Quantitect Reverse Transcription Kit, Qiagen. Hilden, Germany) for 5 min at 42°C. RNA samples were subsequently retrotranscribed to cDNA using the Quantitect Reverse Transcription Kit (Qiagen. Hilden, Germany). Thermal cycling conditions used were denaturation at 95°C for 20 s, 40 cycles of priming at at 54°C for 20 s, and elongation at 72°C for 20 s. Primers used can be consulted in Supplementary Table 1. All reactions were performed in duplicate. Reaction mixtures, without RNA, were used as negative controls in each run. Absence of genomic DNA contamination was confirmed by setting up control reactions that do not contain reverse transcriptase. Fold changes in the expression of genes of interest were calculated using the ΔΔCt method.

The expression levels of circPSMC3, miR‐296‐3p and PTEN in the experimental groups were determined by qRT‐PCR. In strict accordance with the manufacturer's instructions, total RNAs were extracted by TRIzol reagent (Thermo Fisher Scientific, Massachusetts, USA). For circRNA, cDNA was reverse transcribed by a reverse transcription kit (QuantiTect® Reverse Transcription kit; Qiagen) and quantification was performed with a SYBR Green PCR Kit (SYBR® Green Realtime PCR Master Mix; Toyobo). For miRNA, QuantiTect® Reverse Transcription kit (Qiagen, German) was employed to reverse the total RNAs and SYBR Green PCR Kit (Toyobo, Japan) was used to examine the expression level of miR‐296‐3p. The qRT‐PCR primers were designed and synthesized by Sangon Biotech (Shanghai, China). The sequences of the primers used were listed as bellow: forward, 5′‐GTTTAGGGTCCCTGCCCTTTG‐3′ and reverse 5'‐ GTGTTGGGCTGGAAGCCATC‐3′ for circPSMC3; forward, 5'‐TGCCTAATTCAGAGGGTTGG‐3' and reverse, 5'‐CTCCACTCCTGGCACACAG‐3' for miR‐296‐3p; forward, 5'‐GTTTACCGGCAGCATCAAAT‐3 and reverse 5'‐CCCCCACTTTAGTGCACAGT‐3' for PTEN. Before calculation, we normalized the circRNA and miRNA expression levels by GAPDH or U6, respectively.

High vaginal swab samples were stored in 1 ml of RNAlater (Ambion, Australia) in − 80 °C until processed. Total RNA was extracted from the swabs using RNeasy micro kit (Qiagen, Australia), according to the manufacturer’s instructions. The RNA concentration and purity were determined using Nano-drop Spectrophotometer. 0.2 μg of total RNA was reverse transcribed using QuantiTect Reverse transcription kit (Qiagen, Australia), in accordance with the manufacturer’s instructions. For cell culture samples, ECC1, PBMCs and cell’s supernatant were transferred into 1.7 ml Eppendorf tube and centrifuged at 200×g/10 min/4 °C. Cells were resuspended in RNAlater and stored in − 80 °C until processed. Total RNA was extracted from the culture samples using RNeasy mini kit (Qiagen, Australia), according to the manufacturer’s instructions. Prior to the reverse transcription, an additional DNase I step was performed. 0.2 μg of total RNA was reverse transcribed using QuantiTect Reverse transcription kit (Qiagen, Australia), in accordance with the manufacturer’s instructions.

RNA extraction by human gingival fibroblasts and retro-transcription were performed as previously described using RNeasy mini Kit (Qiagen Sciences, Germantown, USA) 9 (link). RNA was quantified using Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies). The RNA samples were stored at -80°C till further use. Genomic DNA elimination reaction was performed using QuantiTect Reverse Transcription Kit (Qiagen, Germany), with thermocycler program: 2' min at 42°C. Reverse-transcription (cDNA synthesis) was carried out using 100ng of RNA and QuantiTect Reverse Transcription Kit (Qiagen Sciences, Germantown, USA), thermocycler program: 15' at 42°C and 3' at 95°C.

Total RNA was isolated from fibroblasts using the RNeasy kit (Qiagen). 500ng of total RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative PCR was performed with the QuantiTect SYBR Green master mix (Qiagen) using primers against APOD, AR and SDHA. All primers were purchased from Qiagen and used following the manufacturer′s instructions. For HEK293T transfections, 500ng RNA extracted using the PARIS kit (Life Technologies) was treated twice with TURBO DNase (Life Technologies) to eliminate residual plasmid DNA and reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). The reverse transcription reaction was also performed in the absence of Reverse Transcriptase. Quantitative PCR was performed with the QuantiTect SYBR Green master mix (Qiagen) using primers against the AR-5′UTR and GFP (S1 Table) and the neomycin resistance gene (neo) [29 (link)]. Primer were designed using the Primer3 software. p-values were calculated using a two-sided t-test.

To investigate the effect of proinflammatory and anti-inflammatory cytokines on G-MSCs' osteogenic potential, the second passage G-MSCs were seeded in 6-well plates at a density of 2 × 10⁴ cells/well in a basic medium. After cell adhesion (day 0), the media were replaced with osteogenic inductive medium according to group allocation described above for 14 days. On day 14, in vitro mineralization was assessed by Alizarin red staining of representative cultures.
On days 1, 3, 7, and 14, the total RNA of cell culture was extracted by RNeasy kit (Qiagen, Hilden, Germany) and purified by QuantiTect Reverse Transcription Kit (Qiagen). Reverse transcription was used to synthesize complementary cDNA by QuantiTect Reverse Transcription Kit (Qiagen). The expression of the bone-specific transcription factor RUNX2, alkaline phosphatase (ALP), type I collagen (Col-I), and osteopontin (OPN) was measured using real-time quantitative polymerase chain reaction (real-time PCR or qPCR) by RealTime ready assays (Roche LightCycle® 96, Roche Molecular Biochemicals, Indianapolis, IN, USA). The house-keeping gene GAPDH was used as a reference to calculate relative gene expression. The designed primers were supplied by Roche (Table 1). All experiments were performed in triplicate and averaged.