Sybr select master mix for cfx

Total RNA was extracted from OC tissues and normal tissues by utilizing TRIzol reagents (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s instructions. The total RNA was reverse-transcribed into cDNA by utilizing a PrimeScript™RT kit with gDNA Eraser (TaKaRa, China). We also constructed Quantitative Real-time PCR (qRT-PCR) by using SYBR Select Master Mix for CFX (Invitrogen) and the CFX Connect Real-Time PCR System (BioRad). The amplification conditions are 95° C for 15s, then 40 cycles, 95° C for 5S, 60° C for the 30s. Primer sequences of FAM83D were as follows: primer F, 5’- GCACTTCCCTTTGTTGTAGTC −3’, primer R, 5’-AGCACTTCCCTTAGGTTACTC −3’. Using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as endogenous control, the recorded data were analyzed and processed by 2−ΔΔCt.

We used TRIzol reagents (Invitrogen, Carlsbad, CA, USA) to extract total RNA from OS cell line according to the instructions provided by manufacturer. The total RNA was reverse-transcribed into cDNA using a PrimeScript™ RT kit with gDNA Eraser (TaKaRa, China). We also used SYBR Select Master Mix for CFX (Invitrogen) and the CFX Connect Real-Time PCR System (BioRad) to perform qRT -PCR. Amplification conditions have been listed below: 95°C for 15 seconds, and then 40 cycles of 95°C for 5 seconds, and 60°C for the 30s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control. Method 2^−ΔΔCt was used to analyze and process the record data. The qRT-PCR primer pairs were as follows [16 (link)]: SRGN forward, 5′-CGCTGCAATCCAGACAGTAA-3′, SRGN reverse, 5′-TCCCAGATCCTGATCCAGAG-3′, GAPDH forward, 5′-TGGTATCGTGGAAGGACTCATGAC-3′, GAPDH reverse, 5′-ATGCCAGTGAGCTTCCCGTTCAGC-3′.

Total RNA from MCF7 cells was isolated using TRIzol^® reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. First‐strand cDNA was synthesized using M‐MLV reverse transcriptase and oligo‐dT (Invitrogen) following the instructions from the manufacturer. Quantitative retro‐transcriptase PCR (qRT‐PCR) assays were performed in duplicate in 96‐well optical plates on an iCycler^® iQ™5 thermal cycler (Bio‐Rad Laboratories) with SYBR Select Master Mix for CFX (Invitrogen) as described previously (Seoane et al., 2016). Levels of MMP13 mRNA were normalized against that of GAPDH and were relativized to those from unstimulated cells using the 2^−(ΔΔCt) method. The sequences of the primers (Invitrogen) used for gene expression analysis are as follows: MMP13 forward 5′‐TTGAGCTGGACTCATTGTCG‐3′, MMP13 reverse 5′‐CGCGAGATTTGTAGGATGGT‐3′, GAPDH forward 5′‐GAGTCAACGGATTTGGTCGT‐3′ and GAPDH reverse 5′‐GATCTCGCTCCTGGAAGATG‐3′. Results are presented as the mean ± SD of two independent experiments.

Total RNA was extracted from OS cell lines with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, China) was used in order to obtain cDNA. Quantitative real-time PCR (qRT-PCR) was performed using SYBR Select Master Mix for CFX (Invitrogen) and the CFX Connect Real-time PCR system (BioRad) at 95 °C for 15 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 34 s. The data were analyzed with the 2^−ΔΔCt method. All of primers are listed in Table 1.

To confirm expression patterns of the PxABCs based on P. xylostella transcriptome, qRT-PCR analysis was performed using SYBR-green fluorescence with gene-specific primers. The PCR products were examined by dissociation curve analysis after the PCR reaction to confirm the specific detection of target transcripts by the qRT-PCR analysis. Three independent biological replicates were included for qRT-PCR, each of which had three technical replicates. The first-strand cDNA was synthesized from total RNA using the reverse transcriptase kit from Promega (Madison, WI). The qRT-PCR reactions were prepared using the SYBR SELECT MASTER MIX FOR CFX from Invitrogen (Carlsbad, CA) following manufacturer’s instructions and run on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA), following the program: 95 °C for 3 min; 45 cycles of 95 °C for 15 s, and 57 °C for 35 s, and a final melt curve at 60 °C for 5 s to 95 °C with 0.5 °C increments. The P. xylostella ribosomal protein L32 (RPL32) gene (GenBank acc. no. AB180441) was used as an internal reference. Standard curves were generated by 5-fold dilutions of the cDNA templates. The 2^−ΔCt method was used to analyze the relative values of mRNA expression.

Total RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) from cultured cells according to the instructions provided by manufacturer. Through PrimeScript™ RT kit with gDNA Eraser (TaKaRa, China), the total RNA was reverse-transcribed into cDNA. Furthermore, qRT-PCR was performed by CFX Connect Real-Time PCR System (Bio-Rad) and SYBR Select Master Mix for CFX (Invitrogen). The amplification conditions were as follows: 95°C for 30s and then 40 cycles of 95°C for 10s, primer temperature 56°C for 20s, and 72°C for 1 min. The CT value data in the reaction were collected by setting the corrected threshold, real-time fluorescence quantitative PCR and 2-△△Ct method. The qRT-PCR primer pairs are listed in Table 3.

Total RNA was collected from cells using TRIzol (Life Technologies/Thermo Fisher Scientific) and reverse transcription was carried out using the Applied Biosystems High Capacity cDNA kit (Life Technologies/Thermo Fisher Scientific). Quantitative PCR was carried out with reference to a standard curve using SYBR Select Master Mix for CFX (Life Technologies/Thermo Fisher Scientific) on a Viia7 Real-Time PCR system (Life Technologies/Thermo Fisher Scientific) and was normalized to 18S rRNA signals. Primers used for quantitative reverse-transcription PCR were as follows (5′ to 3′): 18S-F, GCCGCTAGAGGTGAAATTCTTG; 18S-R, CTTTCGCTCTGGTCCGTCTT; IDO1-F, CCGTAAGGTCTTGCCAAGAAATA; IDO1-R, GTCAGGGGCTTATTAGGATCC; IFNAR1-F, GATTATCAAAAAACTGGGATGG; IFNAR1-R, CCAATCTGAGCTTTGCGAAATGG; IFNAR2-F, GGTTCTCATGGTGTATATCAGC; IFNAR2-R, GCAAGATTCATCTGTGTAATCAGG.