Sirna1

Manufactured by GenePharma

Sourced in China

SiRNA1 is a laboratory equipment product designed for use in RNA interference (RNAi) experiments. It is a tool for the silencing of specific gene expression through the use of small interfering RNA (siRNA) molecules. The core function of SiRNA1 is to facilitate the delivery and incorporation of siRNA into target cells, allowing for the effective knockdown of target genes.

Automatically generated - may contain errors

Lab products found in correlation

57 protocols using sirna1

P2Y2 Gene Silencing Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

P2Y2 gene was silenced with small interfering RNA (siRNA) or small hairpin RNA (shRNA). Two P2Y2 siRNA oligonucleotides (siRNA1 and siRNA2) were purchased from Genepharma (Shanghai, China) and the sequences are as follows: P2Y2 siRNA1, 5′‐GUGCUAACAGUUGCCUUGA‐3′ and P2Y2 siRNA2, 5′‐GCCCAAGAGAUGAACAUCU‐3′. A scramble siRNA oligonucleotide was used as negative control siRNA (designated as NC). Cells were transfected with siRNAs using Lipofectamine RNAiMAX Reagent (Invitrogen). An oligonucleotide labeled with fluorescence was applied to directly observe the efficiency of siRNA transfection.
P2Y2 shRNA plasmid as well as a negative control shRNA (NC) was constructed in our lab as described by Li WH et al.12 By using Lipofectamine 2000 (Invitrogen), we transfected MDA‐MB‐231 cells with P2Y2 shRNA or control shRNA, and selected stable clones using G418 (GIBCO).

Zhang J., Liu Y., Yang H., Zhang H., Tian X, & Fang W. (2017). ATP‐P2Y2‐β‐catenin axis promotes cell invasion in breast cancer cells. Cancer Science, 108(7), 1318-1327.

+ Open protocol

+ Expand

siRNA Knockdown of IgG Constant Region

Check if the same lab product or an alternative is used in the 5 most similar protocols

The siRNAs against Ig gamma chain constant region (siRNA1 and siRNA2) and the control RNA (NC) (siRNA1: 5′-GGUGGACAAGACAGUUGAG-3′, siRNA 2: 5′-AGUGCAAGGUCUCCAACAA-3′, NC: 5′-UUCUCCGAACGUGUCACGU-3′) purchased from Shanghai GenePharma Corporation, China. Cell density was adjusted to 2 × 10⁶/350 μl. The knockdown efficiency of IgG was checked by Western blot.

Liao Q., Liu W., Liu Y., Wang F., Wang C., Zhang J., Chu M., Jiang D., Xiao L., Shao W., Sheng Z., Tao X., Huo L., Yin C.C., Zhang Y., Lee G., Huang J., Li Z, & Qiu X. (2015). Aberrant high expression of immunoglobulin G in epithelial stem/progenitor-like cells contributes to tumor initiation and metastasis. Oncotarget, 6(37), 40081-40094.

+ Open protocol

+ Expand

siRNA-Mediated Knockdown of CRSP8 and IKKα

Check if the same lab product or an alternative is used in the 5 most similar protocols

The siRNAs targeting CRSP8 (siRNA1: 5′-GCGGACGUGAUAAAUGUCAT T-3′ and 5′-UGACAUUUAUCACGUCCGCTT-3′; siRNA2: 5′-CUGGUUAAGAAG UUACAUATT-3′ and 5′-UAUGUAACUUCUUAACCAGTT-3′), siRNAs targeting IKKα (siRNA1: 5′-GCAGGCUCUUUCAGGGACATT-3′ and 5′-UGUCCCUGAAA GAGCCUGCTT-3′; siRNA2: 5′-CAAAGAAGCUGACAAUACUTT-3′ and 5′-AGU AUUGUCAGCUUCUUUGTT-3′), negative control siRNA (5′-UUCUCCGAACGU GUCACGUTT-3′ and 5′-ACGUGACACGUUCGGAGAATT-3′) were purchased from Shanghai GenePharma Co (Shanghai, China). Cells plated in 96-well plates or 6-well plates were transfected with 0.2 or 2 μg of siRNA for each well using Lipofectamine 2000 according to the manufacturer’s instructions. At 48 h after treatment, RNAi efficiency was determined by real-time RT-PCR and western blot.

Liao Y., Hua Y., Li Y., Zhang C., Yu W., Guo P., Zou K., Li W., Sun Y., Wang R., Zuo Y., Sui S., Tian C., Hao J., Chen M., Hu S., Chen M., Long Q., Wang X., Zou L., Xie F., Guo W, & Deng W. (2020). CRSP8 promotes thyroid cancer progression by antagonizing IKKα-induced cell differentiation. Cell Death and Differentiation, 28(4), 1347-1363.

+ Open protocol

+ Expand

Silencing IgG Constant Region

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs against the constant region of the Ig γ-chain (siRNA1, 5′-GGUGGACAAGACAGUUGAG-3′; and siRNA2, 5′-AGUGCAAGGUCUCCAACAA-3′) and the non-silencing control RNA (NC, 5′-UUCUCCGAACGUGUCACGU-3′) were produced by Shanghai GenePharma Co. Ltd. (Shanghai, China). The siRNAs and NC were transfected into the 5637 and BIU87 cell lines using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The knockdown efficiency of IgG was verified by western blot analysis.

Sheng Z., Liu Y., Qin C., Liu Z., Yuan Y., Yin H., Qiu X, & Xu T. (2016). Involvement of cancer-derived IgG in the proliferation, migration and invasion of bladder cancer cells. Oncology Letters, 12(6), 5113-5121.

+ Open protocol

+ Expand

Silencing ciRS-7 Expression with siRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To silence ciRS-7 expression, two small interfering RNAs (siRNAs) (siRNA1 and siRNA2) targeting ciRS-7 and the negative control (siNC) were designed and synthesized by the GenePharm Company (Suzhou, China). siRNAs were then transiently transfected into cells using Lipofectamine 2000 (Invitrogen). Further assays were performed after the transfected cells were cultured for 48 h. The sequences were as follows: siRNA1: 5′-GCACCTGTGTCAAGGTCTTTT-3′; siRNA2: 5′-CTGTTCAGAGTGGATCGTTT-3′; siNC: 5′-TTCTCCGAACGTGTCACGTTT-3′.

Zhao Y.H., Wang Z., Zhang N., Cui T, & Zhang Y.H. (2020). Effect of ciRS-7 expression on clear cell renal cell carcinoma progression. Chinese Medical Journal, 133(17), 2084-2089.

+ Open protocol

+ Expand

Silencing ADM and POLR1D in OSCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The OSCC cell lines CAL-27 (Servicebio, Wuhan, China) and SAS (Cellcook, Guangzhou, China) were cultivated in Dulbecco Modified Eagle Medium F12 (DMEM/F12) (Servicebio, Wuhan, China) supplemented with 10% fetal bovine serum (FBS) (ABW, Shanghai, China) and 100 U/mL penicillin-streptomycin-gentamicin solution (Solarbio, Wuhan, China). Culturing was performed in a CO₂-controlled incubator at 37 °C. A density of 1 × 10⁶ cells was seeded in T-25 cell culture flasks. For transfection, siRNAs targeting ADM (siRNA1-ADM, siRNA2-ADM, siRNA3-ADM), siRNAs targeting POLR1D (siRNA1-POLR1D, siRNA2-POLR1D, siRNA3-POLR1D), and a negative control (siRNA-NC) (GenePharma, Shanghai, China) were transfected into cells using the Lipofectamine™ 2000 transfection kit (Life Technologies, Carlsbad, CA, USA). After 24 h, the expression levels of ADM and POLR1D were assessed via RT-qPCR.

Shi M., Huang K., Wei J., Wang S., Yang W., Wang H, & Li Y. (2024). Identification and Validation of a Prognostic Signature Derived from the Cancer Stem Cells for Oral Squamous Cell Carcinoma. International Journal of Molecular Sciences, 25(2), 1031.

+ Open protocol

+ Expand

Cloning and Knockdown of RLIM and MIZ1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RLIM cDNA was amplified from Marathon fetal liver cDNA library (Takara, Mountain View, California, USA), and subcloned into pCMV-HA/Myc vectors. The pUHD-MIZ1 was kindly provided by Dr. Frank Hanel (Hans Knoell Institute, Germany), and was subcloned into pCDNA3.1+ with an N-terminal Flag tag. All truncation mutants were generated using the KOD-Plus Mutagenesis Kit of Toyobo (Osaka, Japan). The truncation constructs of RLIM and MIZ1 were also subcloned into pCMV-HA/Myc and pCDNA3.1-Flag vector, respectively. Two siRNA oligonucleotides against RLIM were purchased from GenePharma (Shanghai, China) with sequences as follows, siRNA1: 5’-GUUCCAGUUCCAGUCCUAG-3’ and siRNA2: 5’-CACUUGCUCCUCCAAAAUC-3’.

Huang Y., Nie M., Li C., Zhao Y., Li J., Zhou L, & Wang L. (2017). RLIM suppresses hepatocellular carcinogenesis by up-regulating p15 and p21. Oncotarget, 8(47), 83075-83087.

+ Open protocol

+ Expand

siRNA-Mediated Gene Silencing in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The siRNA against human ERCC1, DHRS2, p53 and control siRNA were synthesized by Shanghai GenePharma Co., Ltd. The sequence of the control siRNA was: 5′-UUCUCCGAACGUGUCACGUTT-3′. The target sequences for ERCC1 siRNA were: siRNA1, 5′-GCCAAGCCCUUAUUCCGAUTT-3′; and siRNA2, 5′-GCGACGUAAUUCCCGACUATT-3′. The target sequences for DHRS2 siRNA were: siRNA1, 5′-GCGUGGUUCCAGGAAUUAUTT-3′; and siRNA2, 5′-GCUGUCAUCCUGGUCUCUUTT-3′. The target sequences for p53 siRNA were: siRNA1, 5′-CCACCAUCCACUACAACUATT-3′; and siRNA2, 5′-CCACUGGAUGGAGAAUAUUTT-3′. Cells (1×10⁶/well) were seeded on a 6-well plate and cultured until the next day. They were then transfected with 100 pmol siRNA oligomer mixed with Lipofectamine 2000 reagent (Life Technologies; Thermo Fisher Scientific, Inc.) in serum-reduced medium according to the manufacturer's instructions. After 6 h, the medium was changed to complete culture medium, and the cells were incubated at 37°C in a CO₂ incubator for another 24–48 h before harvest.

Li J.M., Jiang G.M., Zhao L., Yang F., Yuan W.Q., Wang H, & Luo Y.Q. (2019). Dehydrogenase/reductase SDR family member 2 silencing sensitizes an oxaliplatin-resistant cell line to oxaliplatin by inhibiting excision repair cross-complementing group 1 protein expression. Oncology Reports, 42(5), 1725-1734.

+ Open protocol

+ Expand

Brachyury Overexpression/Knockdown Cell Lines

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To construct brachyury overexpression/knockdown cell lines, viral particles containing a small interfering RNA (siRNA-1 and siRNA-2) targeting brachyury or the human brachyury coding region purchased from GenePharma (Suzhou, China) were utilized in H460 cells and Calu-1 cells. The cell lines were constructed as described (9 (link), 18 (link)) previously and validated using western blotting (siRNA-1: CGAATCCACATAGTGAGAGTT; siRNA-2: GAGGATGTTTCCGGTGCTGAA; siRNA-Control: TTCTCCGAACGTGTCACGT).

Xu J., Chen M., Wu Y., Zhang H., Zhou J., Wang D., Zou T, & Shen J. (2020). The Role of Transcriptional Factor Brachyury on Cell Cycle Regulation in Non-small Cell Lung Cancer. Frontiers in Oncology, 10, 1078.

+ Open protocol

+ Expand

Silencing CADM1-AS1 with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two small interfering RNAs (siRNA1 and siRNA2) for CADM1-AS1 silencing and a non-targeting (NT) siRNA were obtained from GenePharma (Shanghai, China). The sequences were as follows: siRNA1, Sense 5ʹ-rGrUrArCrCrUrCrCrUrGrCrCrUrUrUrGrUrCrArArGrCrCAA-3ʹand antisense 5ʹ-rUrUrGrGrCrUrUrGrArCrArArArGrGrCrArGrGrArGrGrUrArCrArA-3ʹ; siRNA2, sense 5ʹ-rGrArCrCrUrArUrCrGrArGrArArCrUrGrArGrArGrCrGrACA-3ʹ and antisense 5ʹ-rUrGrUrCrGrCrUrCrUrCrArGrUrUrCrUrCrGArUrArGrGrUrCrArG-3ʹ. The cells (2×10⁵/ml) seeded in 6-well plates overnight were mixed gently with 5 μg siRNA and 10 μl of Lipofectamine 3000 (Invitrogen, USA) in 250 μl opti-MEM (Gibco) and incubated at 37 °C for 24 h. Then, the medium was replaced with fresh complete medium, and the cells were incubated for a further 24 h.

Wang F., Qi X., Li Z., Jin S., Xie Y, & Zhong H. (2019). lncRNA CADM1-AS1 inhibits cell-cycle progression and invasion via PTEN/AKT/GSK-3β axis in hepatocellular carcinoma. Cancer Management and Research, 11, 3813-3828.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!