Dulbecco modified eagle medium (dmem)

Manufactured by Solarbio

Sourced in China, United States

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium that provides essential nutrients and components to support the growth and maintenance of a wide range of cell types in vitro. It is a commonly used basal medium in cell culture applications.

Automatically generated - may contain errors

Lab products found in correlation

Fetal bovine serum (fbs), by Thermo Fisher Scientific (78 mentions) Fetal bovine serum (fbs), by Solarbio (23 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (17 mentions) Penicillin streptomycin, by Solarbio (14 mentions) Penicillin, by Solarbio (13 mentions) Streptomycin, by Solarbio (13 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (13 mentions) Rpmi 1640, by Solarbio (11 mentions) Rpmi 1640 medium, by Solarbio (10 mentions) Penicillin, by Thermo Fisher Scientific (8 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (8 mentions) Streptomycin, by Thermo Fisher Scientific (7 mentions) Fetal bovine serum (fbs), by Sartorius (7 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (7 mentions) Dimethyl sulfoxide (dmso), by Solarbio (6 mentions) Lipopolysaccharides (lps), by Solarbio (5 mentions) Trypsin, by Solarbio (4 mentions) Horse serum, by Solarbio (4 mentions) Phosphate buffered saline (pbs), by Solarbio (4 mentions) Methyl thiazolyl tetrazolium (mtt), by Solarbio (3 mentions)

211 protocols using dulbecco modified eagle medium (dmem)

Isolation and Pyroptosis Induction in Rat Synovial Fibroblasts

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synovial tissues removed from five 2-month-old male SD rats were snipped into pieces of ~3 mm³, homogenized in DMEM (Gibco; Thermo Fisher Scientific, Inc.) and incubated for 1 h at 37°C with 1 mg/ml type I collagenase (Sigma-Aldrich; Merck KGaA). The samples were filtered through a 100-µm cell strainer. After dissociation, the FLSs were pelleted via centrifugation at 300 × g at ~25°C for 5 min and plated in DMEM supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% antibiotics (100 U/ml penicillin and 100 µg/ml streptomycin; Invitrogen; Thermo Fisher Scientific, Inc.). Cells were cultured at 37°C in a humidified atmosphere with 95% air and 5% CO₂, and were identified as described in our previous studies (9 (link),10 (link)). Primary FLSs from passages 3–5 were used for subsequent experiments.
To induce pyroptosis, FLSs were stimulated with LPS (3 µg/ml; Sigma-Aldrich; Merck KGaA) in DMEM for 12 h and then treated with ATP (Beijing Solarbio Science & Technology Co., Ltd.) at 37°C (3 mM) for 4 h. For the control group, FLSs were treated with DMEM for 12 h and then treated with DMEM in combination with 0.9% saline of the same volume as ATP for 4 h. Compounds in the supernatant were detected using specific ELISA kits. FLSs were collected to detect protein and gene expression levels, and caspase-1 activity, as well as to perform immunofluorescence.

Xiao Y., Ding L., Yin S., Huang Z., Zhang L., Mei W., Wu P., Wang P, & Pan K. (2020). Relationship between the pyroptosis of fibroblast-like synoviocytes and HMGB1 secretion in knee osteoarthritis. Molecular Medicine Reports, 23(2), 97.

+ Open protocol

+ Expand

Investigating Inflammatory Response in Kidney Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TCMK-1 mouse kidney epithelial cell line was purchased from BioVector NTCC Inc. (Beijing, China) and cultured in 90% high-glucose Dulbecco’s modified Eagle medium (DMEM, Solarbio, Beijing, China) and 10% fetal bovine serum (FBS, Solarbio, Beijing, China) at 37°C. After incubation for 24 h, cells were divided into two groups: one group was added with 5 mg/L of lipopolysaccharide (LPS, Solarbio, Beijing, China) to mimic inflammation, and the other group was added with equal amount of DMEM for 2 h at 37°C as control group.
HEK293 cell line was purchased from American Type Culture Collection (ATCC; Manassas, USA) and cultured in Eagle’s Minimum Essential Medium (EMEM, Solarbio, Beijing, China) with 10% FBS at 37°C for dual luciferase reporter assay.
THBS2-small interfering RNA (siTHBS2), miR-106a inhibitor, miR-106a mimics or their negative control (NC), siNC, NC inhibitor and NC mimics were added to cells cultured in 96-well plate to transfect for 48h at 37°C by Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, USA).

Shen Y., Yu J., Jing Y, & Zhang J. (2019). MiR-106a aggravates sepsis-induced acute kidney injury by targeting THBS2 in mice model. Acta Cirúrgica Brasileira, 34(6), e201900602.

+ Open protocol

+ Expand

Glucose and Mannose Effects on HRCP

Check if the same lab product or an alternative is used in the 5 most similar protocols

HRCPs (Cambrex Biosciences, Walkersville, MD, USA) were cultured in DMEM (Solarbio, Beijing, China) at 37°C and 5% CO₂. DMEM contained 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Solarbio). HRCPs were incubated with 5 mM glucose (normal glucose, NG), 30 mM glucose (HG) or 5 mM glucose + 25 mM mannose (Man) with or without 10 mM DAC for 4 d.

Zhu Y., Wang X., Zhou X., Ding L., Liu D, & Xu H. (2021). DNMT1-mediated PPARα methylation aggravates damage of retinal tissues in diabetic retinopathy mice. Biological Research, 54, 25.

+ Open protocol

+ Expand

Culturing Hepatic Stellate and Hepatocyte Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The LX‐2 human hepatic stellate cell and HepG2 cells were obtained from the Institute of Biochemistry and Cell Biology (Chinese Academy of Sciences, Shanghai, China). The LX‐2 cells were cultured in DMEM (Solarbio technology) with 2% foetal bovine serum (FBS; Excell Bio).³⁰ We selected HepG2 as human hepatocyte cell line.³¹, ³² The HepG2 cells were cultured in DMEM (Solarbio Technology) with 10% foetal bovine serum (FBS; Excell Bio). All cells were cultured at 37°C in a 5% CO₂ incubator.

Li X., Shao S., Li H., Bi Z., Zhang S., Wei Y., Bai J., Zhang R., Ma X., Ma B., Zhang L., Xie C., Ning W., Zhou H, & Yang C. (2020). Byakangelicin protects against carbon tetrachloride–induced liver injury and fibrosis in mice. Journal of Cellular and Molecular Medicine, 24(15), 8623-8635.

+ Open protocol

+ Expand

Soft Agar Colony Formation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 300 cells in 1 ml DMEM containing 0.2% agar (Solarbio Science & Technology Co., Beijing, China) and 10% FBS were plated per well into six-well plates coated with 1 ml DMEM containing 0.5% agar and 10% FBS. After 1 week, colonies were stained with crystal violet. Colonies consist of no less than 50 cells were counted. The experiment was performed in triplicates and repeated three times.

Zhao Q., Chen H., Li X., Zeng B., Sun Z., Liu D., Chen Y., Zhang Y., Rosie Xing H, & Wang J. (2022). Low-metastatic melanoma cells acquire enhanced metastatic capability via exosomal transfer of miR-199a-1-5p from highly metastatic melanoma cells. Cell Death Discovery, 8, 188.

+ Open protocol

+ Expand

Transwell Migration and Invasion Assay for HCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCC cells with different transfections were seeded in the upper chamber of the transwell (Solarbio) with serum-free DMEM (Solarbio). The lower chamber contained DMEM (Solarbio) with 10% FBS (Solarbio). The migrated cells were treated with 4% paraformaldehyde (Solarbio) and stained with 0.5% crystal violet (Invitrogen). After 24 h, the migrated cells were examined under a microscope (Olympus), and the percentage of cell migration was calculated. To evaluate cell invasion, the upper chamber of the transwell was coated with Matrigel (Solarbio) beforehand, and the other steps were carried out in line with the migration assay.

ZHAO X, & HE L. (2023). Hsa-circ-0006091 modulates the proliferation of hepatocellular carcinoma via the miR-622/CCNB1 axis. Turkish Journal of Medical Sciences, 53(5), 1367-1378.

+ Open protocol

+ Expand

Preparation and Application of GA and NAT

Check if the same lab product or an alternative is used in the 5 most similar protocols

GA powder (CAS 149-91-7; Macklin Biochemical Co. Ltd., Shanghai, China) was dissolved in phosphate-buffered saline (PBS; Solarbio, Beijing, China) at a storage concentration of 10 mg/mL, and further diluted to the required concentrations with Dulbecco’s Modified Eagle Medium (DMEM; Solarbio) for RAW264.7 cells and human corneal epithelial cells (HCECs), and Sabouraud liquid medium which contains protein, agar, and glucose for fungal conidia treatment.
Natamycin (NAT) powder (CAS 7681-93-8; Macklin Biochemical Co. Ltd., Shanghai, China) was dissolved in PBS (Solarbio) at a storage concentration of 8 mg/mL, and further diluted to the required concentrations with DMEM (Solarbio) for RAW264.7 cells, and Sabouraud liquid medium for fungal conidia treatment.

Luan S., Peng X., Lin J., Zhang Y., Zhan L., Yin J., Luan J., Ji X, & Zhao G. (2022). Gallic Acid Ameliorates Aspergillus Fumigatus Keratitis Through Reducing Fungal Load and Suppressing the Inflammatory Response. Investigative Ophthalmology & Visual Science, 63(12), 12.

+ Open protocol

+ Expand

Anchorage-Independent Cell Growth Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 200 cells in 1 ml DMEM containing 0.2% agar (Solarbio Science & Technology Co., Beijing, China) and 10% FBS were plated per well into 6-well plates coated with 1 ml DMEM containing 0.5% agar and 10% FBS. After 1 week, colonies were stained with crystal violet and colonies consist of no less less 50 cells counted. The experiment was performed in triplicate and repeated three times.

Sun Z., Zhou S., Tang J., Ye T., Li J., Liu D., Zhou J., Wang J, & Rosie Xing H. (2018). Sec23a mediates miR-200c augmented oligometastatic to polymetastatic progression. EBioMedicine, 37, 47-55.

+ Open protocol

+ Expand

Regulation of Lung Cancer Cell Lines by circCDR1as and SOX5

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human lung cancer cell lines (A549, Calu‐3, CAEP and SK‐MES‐1) and human bronchial epithelioid cells (HBE) were purchased from BeNa Culture Collection (Beijing, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM) (Solarbio, Beijing, China) containing 10% fetal bovine serum (Zhejiang Tianhang Biotechnology, Huzhou, China) and 1% penicillin‐streptomycin solution (Procell, Wuhan, China).
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.

Li Y., Zhang J., Pan S., Zhou J., Diao X, & Liu S. (2020). CircRNA CDR1as knockdown inhibits progression of non‐small‐cell lung cancer by regulating miR‐219a‐5p/SOX5 axis. Thoracic Cancer, 11(3), 537-548.

+ Open protocol

+ Expand

Cell Culture and Viral Strains Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

MARC-145, HEK-293T, HeLa, and CRL-2843-CD163 cell lines were stored in our laboratory (71 (link)). MARC-145 and HEK-293T cells were maintained in DMEM (Solarbio, Cat. No. 12100) supplemented with 10% heat-inactivated FBS (Gibco, Cat. No. 10270–106), and 100 units mL⁻¹ penicillin and 100 mg mL⁻¹ streptomycin sulfate (Sangon, Cat. No. B540732) at 37°C in 5% CO₂. HeLa cells were routinely maintained in modified Eagle medium (iCell Bioscience Inc., Cat. No. 138–0012) supplemented with 10% heat-inactivated FBS and 100 units mL⁻¹ penicillin and 100 mg mL⁻¹ streptomycin sulfate at 37°C in 5% CO₂. CRL-2843-CD163 cells were maintained in Roswell Park Memorial Institute 1640 medium (Solarbio, Cat. No. 31800) supplemented with 10% FBS and 100 units mL⁻¹ penicillin and 100 mg mL⁻¹ streptomycin sulfate at 37°C in 5% CO₂.
HP-PRRSV strain HN07-1 (GenBank: KX766378.1) and NADC30-like PRRSV strain HNhx (GenBank: KX766379) were previously isolated by our laboratory (72 (link), 73 (link)). Low-pathogenic PRRSV strain BJ-4 (GenBank: AF331831) was kindly provided by Professor Hanchun Yang of China Agricultural University. The HP-PRRSV strain HN07-1 was utilized in the current study unless otherwise stated.

Zhao S.S., Qian Q., Chen X.X., Lu Q., Xing G., Qiao S., Li R, & Zhang G. (2024). Porcine reproductive and respiratory syndrome virus triggers Golgi apparatus fragmentation-mediated autophagy to facilitate viral self-replication. Journal of Virology, 98(2), e01842-23.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!