Parasite samples with P. falciparum confirmed by PCR following the methodology previously published [35 (link)] were selected for sequencing of antimalarial drug resistance loci including: pfmdr1 (PF3D7_0523000; including codons 86, 184 and 1246) and pfk13 (PF3D7_1343700; including codons from 412 to codon 723). Genes were PCR amplified following the methodology previously published [34 (link)] with modifications (primers and thermocycling conditions in Table S1 ) and products cleaned using SureClean (Bioline, USA) following manufacturer’s instructions. The PCR products were analyzed by electrophoresis on a 2% agarose gel stained with GreenSafe (Nzytech, Portugal) to confirm amplification. The PCR products were sequenced using Sanger capillary platform at Eurofins Genomics, Germany, and the resulting sequences were analyzed using BLAST: Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi ; accessed on 18 August 2021). The laboratory-adapted 3D7 clone (MRA-102) was used as reference.
Sureclean
Manufactured by Meridian Bioscience
Sourced in United States, Germany
SureClean is a laboratory product designed to facilitate the cleaning and decontamination of laboratory equipment. It is a cleaning solution formulated to effectively remove various contaminants from laboratory surfaces and instruments.
Automatically generated - may contain errors
Lab products found in correlation
Greensafe, by NZYTech (1 mentions)
Sequencher, by Gene Codes (1 mentions)
Quickextract, by Illumina (1 mentions)
Genemapper 5, by Thermo Fisher Scientific (1 mentions)
Genescan 500 rox, by Thermo Fisher Scientific (1 mentions)
Restriction endonuclease, by New England Biolabs (1 mentions)
Genetools program, by Syngene (1 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (1 mentions)
Abi 3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Abi big dye terminator mix, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pgem t easy, by Promega (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Biomix, by Meridian Bioscience (1 mentions)
Abi 3730 dna analyser, by Thermo Fisher Scientific (1 mentions)
10 protocols using sureclean
1
Sequencing of Antimalarial Drug Resistance Loci in Plasmodium falciparum
2
Mitochondrial DNA Sequencing of Sperm Whale Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of the sperm whale skin and skeletal muscle were collected and frozen at −20 °C. Samples of DNA were extracted from each tissue type using QuickExtract (Epicentre, Madison, WI, USA) following the manufacturer’s protocols. Two replicate for each tissue type was done to minimize the likelihood of reporting erroneous sequences because of sequencing error. A section of the mitochondrial DNA control region was targeted using primers and PCR protocols from Southern, Southern & Dizon (1988) (link) with a negative control. The resulting PCR product was visualized under UV light after GelRed™ agarose gel electrophoresis. Successful product from PCR was purified using SureClean (Bioline). Cycle sequencing was performed using BigDye Terminator PCR (Applied Biosystems, Foster City, CA, USA) in both directions following the manufacturer’s instructions. The resulting single-stranded DNA were purified with CleanSEQ magnetic beads (Agencourt Bioscience Corp), and sequenced on an ABI 3100xl genetic analysis sequencer (Applied Biosystems). The resulting sequences were aligned and edited using the software Sequencher (Gene Codes Corporation, Ann Arbor, WI, USA), and haplotype matching followed Engelhaupt et al. (2009) (link).
3
Generation of dsRNA Probes for Gene Knockdown
4
Generating Drosophila Toll Receptor dsRNA Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
dsRNA probes were made using PCR product containing the sequence of the T7 promoter (TAATACGACTCACTATAGGG) followed by 18-21 nucleotides specific to the gene. The dsRNA probe against Toll-2 (18w, CG8896) is 393-bp long and located in the 5’UTR region (Forward primer: AGTTTGAATCGAAACGCGAGGC; Reverse primer: ATGCCAGCCACATCTTCCA). The dsRNA probe against Toll-6 (CG7250) is 518-bp long and located in the 5’UTR region (Forward primer: TCGAAAATCAGCCAACGTGC; Reverse primer: CGATTCACGGTTTAGCTGCG). The dsRNA probe against Toll-7 (CG8595) is 749-bp long and located in the coding region (Forward primer: TGGCAACCGTCTGGTTACTC; Reverse primer: CGTTCATGATGCTCTGCGTG). The dsRNA probe against Toll-8 (Tollo, CG6890) is 423-bp long and located in the 5’UTR region (Forward primer: CGTTTGTCGTTCAGCGGATG; Reverse primer: CCCCTCATAACCTCCCCGAT) and does not target the ind-Toll-8::HA transgenes. Gel purified PCR products were subsequently used as a template for the in vitro RNA synthesis with T7 polymerase using Ribomax (Promega, P1300). The dsRNA probes were purified using Sure-Clean (Bioline, BIO-37047). Triple dsRNA probes against Toll-2,6,8 and Toll-2,6,7 were prepared and injected at a final concentration of 5 μM each in RNAse-free water.
5
Bacterial and Methanogenic Community Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The T-RFLP analysis of bacterial and methanogenic communities using FAM-labeled PCR products was done as described previously (Sträuber et al., 2012 (link); Lucas et al., 2015 (link)). PCR product quality was checked by agarose gel electrophoresis and amplicons were purified with SureClean (Bioline, Luckenwalde, Germany). Purified PCR products were quantified after electrophoresis in 1.5% agarose gels with ethidium bromide staining using the GeneTools program (Syngene, Cambridge, UK). The purified PCR products were digested with restriction endonucleases purchased from New England Biolabs (Schwalbach, Germany). The mcrA amplicons were digested with MwoI and the 16S rRNA amplicons with RsaI, using 2 units of the respective enzyme for digesting 10 ng of PCR product at 37°C overnight. The subsequent T-RFLP analysis was done for the mcrA amplicons with the GeneScanTM-500RoxTM (Applied Biosystems, USA) as fragment size standard and for the 16S rRNA amplicons with the MapMarker1000 (BioVentures Inc., USA). Resulting electropherograms were analyzed by using the GeneMapper 5 software (Applied Biosystems) and processed according to Abdo et al. (2006) (link). To differentiate between peaks and background, signals with low peak areas were removed according to eight times the standard deviation.
6
Metabarcoding of Mitochondrial COI Gene in Scrubwrens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We amplified 313 bp of the mitochondrial COI gene [39 ] using universal metazoan primers [40 (link), 41 (link)] with a 9 bp barcode which differed across samples in at least 4 bases. The following PCR conditions were used: initial denaturation at 94 °C for five minutes, denaturation at 94 °C for 30 s, annealing at 48 °C and extension at 72 °C for a minute each for 35 cycles. Final extension was carried out at 72 °C for five minutes. Samples were pooled at equal concentrations, cleaned using SureClean (Bioline Inc., London) following the manufacturer’s instructions, and sequenced on a MiSeq platform using a 300 bp paired-end run. Sequences were edited and assembled following Meier et al. [39 ] and samples with at least 10X coverage were used for further analyses. Based on these criteria, we were able to successfully amplify the COI gene fragment for 75 samples (Table S1 ).
In addition to the sequences generated in this study, we also included COI sequences for other scrubwrens from GenBank (Table S6 ). We performed multiple COI sequence alignments using MAFFT [42 (link)]. A phylogenetic haplotype network was constructed using the TCS method [43 (link)] in PopART 1.7 [44 ]. Pairwise net p-distances between species were computed in MEGA 7 [45 ].
In addition to the sequences generated in this study, we also included COI sequences for other scrubwrens from GenBank (Table S
7
Mitochondrial DNA Sequencing of Palaemon Shrimps
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction, amplification and sequencing protocols followed Schubart et al. (2000) with modifications as in Mantelatto et al. (2007 , 2009 ) and Pileggi and Mantelatto (2010) . Total genomic DNA was extracted from the muscle tissue of the abdomen. An approximately 550 bp region of the mitochondrial 16S rRNA gene was amplified from four specimens of PageBreakPalaemon carteri Palaemon ivonicus Palaemon yuna 1 ). The amplification was performed by polymerase chain reaction (PCR) in an Applied Biosystems Veriti 96 Well Thermal Cycler® (thermal cycles: initial denaturing for 5 min at 95 °C; pairing for 40 cycles: 45 s at 95 °C, 45 s at 52 °C, 1 min at 72 °C; final extension 5 min at 72 °C) with universal 16S mtDNA primers 1472 (5’-AGATAGAAACCAACCTGG-3’) (Crandall and Fitzpatrick 1996 ) and 16S-L2 (5’-TGCCTGTTTATCAAAAACAT-3’) (Schubart et al. 2002 ). PCR products were purified using Sure Clean (Bioline) and sequenced with the ABI Big Dye® Terminator Mix (Applied Biosystems, Carlsbad, CA) in an ABI 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA) following Applied Biosystems protocols. All sequences were confirmed by sequencing both strands. A consensus sequence for the two strands was obtained using the BIOEDIT software (version 7.0.5) (Hall 2005 ).
8
Plant DNA Extraction and PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated using the DNAeasy Plant Mini Kit according to the manufacturer's instructions (Quiagen). PCR reactions were carried out using Phusion High-Fidelity DNA polymerase (Thermo Scientific™) with 20 ng of plant genomic DNA. PCR products were analysed using non-denaturing polyacrylamide. The primers used in this work are listed in Table S1 PCR amplification products were sequenced by Sanger technology, either directly after purification with SureClean (Bioline) or after cloning them in pGEMTeasy (Promega)
9
Isolating and Sequencing Trichuris Parasites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trichuris sp. adult specimens were collected during necropsies carried out at the Istituto Zooprofilattico Sperimentale del Lazio e della Toscana ''M. Aleandri'' to ascertain the cause of death of two M. fuscata and one C. aethiops, formerly housed in the Bioparco of Rome, in strict accordance with good animal practices and veterinary inspection procedures.
Adult whipworms from each host were washed in physiological saline, morphologically identified as Trichuris sp. according to Jenkins (1970) and Ooi et al. (1993) and fixed in 70% ethanol until molecular analyses. Total genomic DNA was isolated from 19 specimens from M. fuscata and from 7 specimens from C. aethiops using the Wizard Genomic DNA Purification kit (Promega), according to instructions. The amplification of ITS1-5.8S-ITS2 region was performed as in Ravasi et al. (2012) , including positive and negative control to each run. Positive amplicons were purified using Sure Clean (Bioline) and shipped to external service for sequencing (MWG Eurofins Operon).
Adult whipworms from each host were washed in physiological saline, morphologically identified as Trichuris sp. according to Jenkins (1970) and Ooi et al. (1993) and fixed in 70% ethanol until molecular analyses. Total genomic DNA was isolated from 19 specimens from M. fuscata and from 7 specimens from C. aethiops using the Wizard Genomic DNA Purification kit (Promega), according to instructions. The amplification of ITS1-5.8S-ITS2 region was performed as in Ravasi et al. (2012) , including positive and negative control to each run. Positive amplicons were purified using Sure Clean (Bioline) and shipped to external service for sequencing (MWG Eurofins Operon).
10
mtDNA COI Gene Fragment Amplification and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 501bp fragment of the mtDNA cytochrome oxidase I (COI) gene was amplified using PCR with unpublished species-specific primers DCCOIF (5' TCATTCCGAGCCGAACTAAGC 3') and DCCOIR (5' TCCTGCAGGGTCAAAGAAAG 3'). PCRs comprised of 10 µl of BIOMIX (BioLine), 1.0 pMol of primer (both forward and reverse), 6 µl of template DNA and 2 µl of sterile distilled water giving a total reaction volume of 20µl. All PCRs were performed using the following reaction conditions: 120 s at 95°C, then 40 cycles of 30 s at 94°C, 30 s at 50°C, 60 s at 72°C, with a final extension step of 120 s at 72°C. PCR amplicons were cleaned using SureClean (BioLine) and sequenced in both directions using Big Dye technology on an ABI 3730 DNA analyser (Applied Biosystems®). Sequence chromatograms were examined and edited in CHROMAS (Technelysium ltd) and aligned using CLUSTAL W executed in BIOEDIT (Hall, 1999) .
Genetic variation was described using haplotype diversity (h, Nei and Tajima, 1981) with differentiation among samples quantified by Φ ST (with significance assessed by 10 000 permutations) using ARLEQUIN 3.5 (Excoffier & Lischer, 2010) . A median joining network was constructed in NETWORK (www.fluxus-engineering.com/sharenet.htm).
Genetic variation was described using haplotype diversity (h, Nei and Tajima, 1981) with differentiation among samples quantified by Φ ST (with significance assessed by 10 000 permutations) using ARLEQUIN 3.5 (Excoffier & Lischer, 2010) . A median joining network was constructed in NETWORK (www.fluxus-engineering.com/sharenet.htm).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!