Microamp optical 96 well reaction plate

cDNA synthesis from the samples was conducted with the NZY First-Strand cDNA Synthesis kit (NZYTech) using 0.5 μg of total RNA. A total of 12 lncRNAs were used to validate the RNA-Seq results. Specific qPCR primers for the selected lncRNAs were designed using Primer 3 software^{29 (link)}, and their amplification efficiency was calculated with the threshold cycle (CT) slope method^{30 (link)}. The primer sequences used for qPCR are listed in Supplementary Table S1. Individual qPCR assays were carried out in a 25 μl reaction volume containing 12.5 μl of SYBR GREEN PCR Master Mix (Applied Biosystems), 10.5 μl of ultrapure water, 0.5 μl of each specific primer (10 μM) and 1 μl of two-fold-diluted cDNA template in MicroAmp optical 96-well reaction plates (Applied Biosystems, USA). Reactions were conducted using technical triplicates in a 7300 Real-Time PCR System thermocycler (Applied Biosystems). The qPCR conditions were as follows: initial denaturation step (95 °C, 10 min), 40 cycles of a denaturation step (95 °C, 15 s) and a hybridization-elongation step (60 °C, 1 min). The relative expression level of the lncRNAs was normalized following the Pfaffl method^{30 (link)} and using the 18S ribosomal RNA (18 s) as a reference gene.

The relative levels of AIM2 mRNA were analyzed in freshly isolated cells or in cells that had been activated in vitro. Briefly, cells were lysed with 350 μl lysis buffer (Qiagen, Hilden, Germany). Total RNA was extracted with an RNeasy Micro kit (Qiagen) and treated with DNase (Qiagen) to remove genomic DNA, using the QIACube (Qiagen). cDNA was prepared in a random hexamer-primed Superscript (Invitrogen, Carlsbad, CA, USA) RT reaction. The mRNA levels were determined by RT-PCR on a ViiA^™ 7 Real-Time PCR System (TaqMan; Applied Biosystems, Foster City, CA, USA) using MicroAmp Optical 96-well reaction plates (Applied Biosystems). The primer-probe pairs were AIM2 (Hs00915710_m1), IFI16 (Hs00986757_m1), NLRP3 (Hs00918082_m1) and GAPDH (Hs99999905_m1) (TaqMan, Applied Biosystems). The samples (10 ng of cDNA) were run in duplicates in a 20-μl reaction mix (with TaqMan Universal PCR Master Mix; Applied Biosystems) using the comparative ΔΔCT method of relative quantification to calculate the differences in gene expression between control and antigen stimulated cells. As an endogenous control, GAPDH was used to correct for variations in sample loading. The samples were normalized to a standard consisting of a pool of cDNA from 10 adults that were set to 1.

cDNA synthesis of the samples was conducted with the NZY First-Strand cDNA Synthesis kit (NZYTech, Lisbon, Portugal) using 0.5 µg of total RNA. A total of 12 lncRNAs were used to validate the RNA-Seq results. Specific qPCR primers for the selected lncRNAs were designed using Primer 3 software [30 (link)], and their amplification efficiency was calculated with the threshold cycle (CT) slope method [31 (link)]. Primer sequences are listed in Supplementary Table S1. Individual qPCR reactions were carried out in a 25-µL reaction volume containing 12.5 µL of SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 10.5 µL of ultrapure water, 0.5 µL of each specific primer (10 µM) and 1 µL of two-fold diluted cDNA template in MicroAmp optical 96-well reaction plates (Applied Biosystems). Reactions were conducted using technical triplicates in a 7300 Real-Time PCR System thermocycler (Applied Biosystems). qPCR conditions consisted of an initial denaturation step (95 °C, 10 min) followed by 40 cycles of a denaturation step (95 °C, 15 s) and one hybridization-elongation step (60 °C, 1 min). The relative expression level of the lncRNAs was normalised following the Pfaffl method [31 (link)] and using 18S ribosomal RNA (18S) as a reference gene.

Polymerase chain reaction for HCV was performed as previously described [15] (link). HCV antibodies were investigated by a third generation enzyme-linked immunosorbent assay (ELISA) (Ortho Diagnostic System Inc., Raritan, NJ) and confirmed by Western blot analysis (Innogenetics, Zwijndrecht, Belgium). IFNL3 rs12979860 SNP genotyping was performed using Allelic Discrimination assays from Applied Biosystems following the instructions of the manufacturer. Genotyping was performed using Taqman custom-designed primers and probes as follows: forward primer GCCTGTCGTGTACTGAACCA, reverse primer GCGCGGAGTGCAATTCAAC, and probes TGGTTCGCGCCTTC (VIC) and CTGGTTCACGCCTTC (FAM) (Applied Biosystems). Before performing the PCR reactions DNA is added with Allelic Discrimination Assay Mix and TaqMan Universal PCR Master Mix to MicroAmp Optical 96-Well Reaction Plates (Applied Biosystems). Real-Time PCR reactions were performed using the 7500 Fast Real-Time PCR System. After preheating for 10 min. at 92°C, 40 cycles of 15 seconds at 95°C and one minute at 60°C followed. Data were analyzed using the ABI SDS software (Applied Biosystems).

The SNPs included in this study were chosen from previous reports with other respiratory diseases or COPD studies and minor allele frequency (MAF) > 10% reported in the 1000 genomes and/or Hapmap project for the population with Mexican Ancestry in Los Angeles.
SNPs were genotyped using specific sequence TaqMan probes (Applied Biosystems, CA. USA) and the allelic discrimination was carried out using 7300 Real-time PCR system (Applied Biosystems, Foster City CA, USA). Genotype assignment and data interpretation were conducted using the Sequence Detection Software (SDS v. 1.4, Applied Biosystems).
The amplification reaction was prepared in MicroAmp^® Optical 96-well Reaction Plates (Applied Biosystems; Woolston, UK); each well contained, 3 µL of adjusted DNA from one subject and 5 µL of the amplification mix, composed by corresponding TaqMan probe, TaqMan™ Universal PCR Master Mix (Applied Biosystems; Woolston, UK) and nuclease-free water (Maxim Biotech, San Francisco, CA, USA) to adjust the final reaction volume. Each plate included 3 non-template control (NTC) wells as contamination control and 1% of the samples were duplicated as allele assignment control.