Mx3000

For all of the trials, moribund oysters from the selected and control lines were sampled for the detection of OsHV-1 and V. aestuarianus DNA. Total DNA was extracted from tissue fragments (mantle + gills) using the QIAgen (Hilden, Germany) QIAamp tissue mini kit combined with the QIAcube automated system according to the manufacturer’s protocol. The total DNA amount was adjusted to 5 ng/µL following Nanodrop (Thermo Scientific) measurement.
A real-time PCR assay was conducted on the MX3000 and MX3005 Thermocyclers (Agilent) using the Brilliant III Ultrafast kit (Stratagene). Each reaction was run in duplicate in a final volume of 20 µL containing the DNA sample (5 µL at a 5 ng/µL concentration), 200 nM of each primer (for OsHV-1, DPF 5′ ATT GAT GATGTG GAT AAT CTG TG 3′ and DPR 5′ GGT AAA TAC CAT TGG TCT TGTTCC 3′ [26 (link)] and for V. aestuarianus, DNAj-F 5′ GTATGAAATTTTAACTGACCCACAA3′ and DNAj-R 5′ CAATTTCTTTCGAACAACCAC 3′ [27 (link)]) and 200 nM of an oligonucleotide probe (for V. aestuarianus DNAj, probe 5′ TGGTAGCGCAGACTTCGGCGAC). The real-time PCR cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of amplification at 95 °C for 5 s and 60 °C for 20 s. For OsHV-1 DNA quantification, melting curves were also plotted (55-95 °C) to ensure that a single PCR product was amplified for each set of primers. Negative controls (without DNA) were included.

In each experiment, the moribund oysters were sampled for detection of V. aestuarianus and OsHV-1 DNA (Table 1). Total DNA was extracted from tissue fragments (mantle and gills) using the QIAgen (Hilden, Germany) QIAamp tissue mini kit combined with the use of the QIAcube automate, according to the manufacturer’s protocol. The amount of total DNA was adjusted to 5 ng/µL after quantification with a Nanodrop instrument (Thermo Scientific).
A real-time PCR assay was conducted on the MX3000 and MX3005 thermocyclers (Agilent) using the Brilliant III Ultrafast kit (Stratagene). Each reaction was run in duplicate in a final volume of 20 µL containing the DNA sample (5 µL at 5 ng/µL), 200 nM of each primer (for OsHV1-µvar: DPF 5′ ATT GAT GATGTG GAT AAT CTG TG 3′ and DPR 5′ GGT AAA TAC CAT TGG TCT TGTTCC 3′ [40 (link)]; for V. aestuarianus: DNAj-F 5′ GTATGAAATTTTAACTGACCCACAA 3′ and DNAj-R 5′ CAATTTCTTTCGAACAACCAC 3′ [41 (link)]), and 200 nM of oligonucleotide probe (for V. aestuarianus DNAj: 5′ TGGTAGCGCAGACTTCGGCGAC). Real-time PCR cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of amplification at 95 °C for 5 s, 60 °C for 20 s. For quantification of OsHV-1 DNA, melting curves were also plotted (55–95 °C) to ensure that a single PCR product was amplified for each set of primers. Negative controls (without DNA) were included.

Fifteen DEGs were selected as candidates to analyze their expression differences in the spermathecae of queens that response to mating by RT-qPCR using a Stratagene Mx3000 real-time PCR system (Agilent, United States). The primers were designed with Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi), and the primer sequences are shown in Supplementary Table S1. First-strand cDNA samples were diluted (1:10 v/v) with DEPC-treated water. Amplification was carried out in a 20 µL reaction volume containing 10 µL of 10 × TB Green Master Mix (Takara, Dalian, China), 2 µL cDNA, and 0.5 µL of each primer at 10 µm. Quantitative measurements were normalized using β-actin and RP49. The qPCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, and 63°C for 1 min. RT-qPCR was performed in duplicate on each of three independent biological replicates. All results are presented as the mean ± SEM of the biological replicates. The relative quantities of transcripts were calculated using the comparative Ct method (Livak and Schmittgen, 2001 (link)).

The presence of GFP-tagged bacteria and bacterial counts were measured in 100 μl of sampled seawater by flow cytometry (Coulter Epics XL cytometer, Beckman®, and CyFlow Cube 6 Robby Partec®) on 10,000 events or after 5 min with a fixed threshold of FL1 fluorescence. This method enabled measurement of a concentration of V. aestuarianus ≥10³ bacteria/mL. V. aestuarianus DNA amounts were measured by qPCR detection methods (8 (link)) in oyster tissues (50 mg) or seawater (100 μL) after DNA extraction via QiaAmp® tissue kit procedures (Qiagen®) and total-DNA adjustment to 5 ng/μL when needed. A standard curve was built by means of serially diluted titrated genomic extracts (12 (link)). Assays were performed on MX3000 and MX3005 machines (Agilent®) with the Brilliant III Ultrafast kit (Stratagene®).

An Agilent Stratagene Mx3000 or Mx3005 was used to test the operation of the DNA-based circuits in the absence of hydrogel particles. A reporter complex, using FAM and IowaBlackFQ fluorophore-/quencher-modified DNA, was designed to increase measured fluorescence upon reaction with DNA strands containing the Catalyst sequence and toehold (Supplementary Fig. 19). The measured fluorescence increase was converted into the concentration of Catalyst strand using a calibration curve. The DNA strand-displacement logic circuit was tested using 200 nM Source complexes and 200 nM Reporter. Aptasensor circuits were tested at 100 nM Source complexes, 100 nM Cofactor strand, and 200 nM Reporter. PolyT₂₀ (1 µM) was added to inhibit adsorption to well walls.