Log In Sign up
The largest database of trusted experimental protocols

Purelink mini kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, United Kingdom

The PureLink Mini Kit is a nucleic acid purification system designed for the extraction and purification of DNA from various sample types. It utilizes a simplified spin-column format to efficiently isolate high-quality DNA from small sample volumes.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (9 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (7 mentions) Bioanalyzer, by Agilent Technologies (6 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions) Itaq universal sybr green supermix, by Bio-Rad (2 mentions) Omniscript reverse transcriptase kit, by Qiagen (2 mentions) Sybr green kit, by Roche (2 mentions) Lightcycler 480, by Roche (2 mentions) Purelink dnase kit, by Thermo Fisher Scientific (2 mentions) Hiseq 2000, by Illumina (2 mentions) Biophotometer, by Eppendorf (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Taq polymerase, by New England Biolabs (2 mentions) Superscript 3 rt, by Thermo Fisher Scientific (2 mentions) Purelink dnase, by Thermo Fisher Scientific (2 mentions) Superscript vilo kit, by Thermo Fisher Scientific (2 mentions) Taqman fast advanced master mix, by Thermo Fisher Scientific (2 mentions) Qscript cdna supermix, by Quanta Biosciences (2 mentions) Nanodrop 2000 uv vis spectrophotometer, by Thermo Fisher Scientific (2 mentions) Taqman universal master mix, by Thermo Fisher Scientific (2 mentions)

43 protocols using purelink mini kit

1

Quantification of PLC Beta Isoforms

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from HEK293-tsA201 and stable HEK293-TRPM7 cells with Pure Link ® mini kit (Invitrogen, Grand Island, NY) according to the manufacturer’s instruction. First-strand cDNA was synthesized by reverse transcription of 2 μg of total RNA with SuperScript® III First-Strand Synthesis System (Invitrogen) following standard protocols. Q-PCR was performed on MX3000P® system (Stratagene) with iTaq Universal SYBR® Green Supermix (Bio-Rad) according to the manufacturer's instruction. The reaction was conducted as follows; 95°C for 3 min followed by 40 repetitive thermal cycles (95°C for 15 s, 55°C for 30 s, 72°C for 20 s). Primers were purchased from Integrated DNA Technologies. Primer sequences were as follows [29 (link)]: PLCβ1 (sense 5’- AGC TCT CAG AAC AAG CCT CCA ACA-3’ antisense 5’-ATC ATC GTC GTC GTC ACT TTC CGT-3’); PLCβ2 (sense 5’-AAG GTG AAG GCC TAT CTG AGC CAA-3’ antisense 5’-CTT GGC AAA CTT CCC AAA GCG AGT-3’); PLCβ3 (sense 5’-TAT CTT CTT GGA CCT GCT GAC CGT-3’ antisense 5’-TGT GCC CTC ATC TGT AGT TGG CTT-3’); PLCβ4 (sense 5’-GCA CAG CAC ACA AAG GAA TGG TCA-3’ antisense 5’-CGC ATT TCC TTG CTT TCC CTG TCA-3’); GAPDH (sense 5’-CGA GAT CCC TCC AAA ATC AA-3’ antisense 5’-GTC TTC TGG GTG GCA GTG AT-3’). The message level of each gene was normalized to that of GAPDH.
Seo J.B., Jung S.R., Huang W., Zhang Q, & Koh D.S. (2015). Charge Shielding of PIP2 by Cations Regulates Enzyme Activity of Phospholipase C. PLoS ONE, 10(12), e0144432.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using a PureLink™ Mini Kit (Invitrogen, Paisley, UK), and cDNA synthesised using an Omniscript reverse transcriptase kit (Qiagen, Crawley, UK). Primers were designed using NCBI Primer-BLAST (Table 1) and purchased from Eurofins MWG (Ebersberg, Germany). qPCR was performed using a Roche SYBR Green kit (Roche Diagnostics, Burgess Hill, UK) on a Roche Lightcycler® 480. Melt curves were used to confirm reaction specificity and cyclophilin, beta actin and GAPDH were used as housekeeping genes. mRNA quantities were normalised to housekeeping genes using Roche Lightcycler® 480 advanced relative quantification Primer Design.
Dunford L.J., Sinclair K.D., Kwong W.Y., Sturrock C., Clifford B.L., Giles T.C, & Gardner D.S. (2014). Maternal protein-energy malnutrition during early pregnancy in sheep impacts the fetal ornithine cycle to reduce fetal kidney microvascular development. The FASEB Journal, 28(11), 4880-4892.
+ Open protocol
+ Expand
3

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using a PureLink Mini Kit (Invitrogen, Paisley, UK), and cDNA was synthesized using an Omniscript reverse transcriptase kit (Qiagen, Crawley, UK). Primers were designed using U.S. National Center for Biotechnology Information (NCBI) Primer-BLAST (NCBI, Bethesda, MD, USA; Table 1) and purchased from Eurofins MWG (Ebersberg, Germany). qPCR was performed using a Roche SYBR Green kit (Roche Diagnostics, Burgess Hill, UK) on a Roche Lightcycler 480 (Roche, Basel, Switzerland). Melt curves were used to confirm reaction specificity, and cyclophilin, β-actin, and GAPDH were used as housekeeping genes. mRNA quantities were normalized to housekeeping genes using Roche Lightcycler 480 advanced relative quantification software.
Dunford L.J., Sinclair K.D., Kwong W.Y., Sturrock C., Clifford B.L., Giles T.C, & Gardner D.S. (2014). Maternal protein-energy malnutrition during early pregnancy in sheep impacts the fetal ornithine cycle to reduce fetal kidney microvascular development. The FASEB Journal, 28(11), 4880-4892.
+ Open protocol
+ Expand
4

RNA Extraction from Liver Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from frozen liver samples (approximately 3–4 mm cubes) from the PND 4 left lateral hepatic lobe, using the Invitrogen PureLink Mini kit (Invitrogen cat# 12183–018A, Carlsbad, CA) according to the manufacturer’s protocol. RNA concentration and quality were measured on a Bioanalyzer (Agilent Technologies, Santa Clara, CA). Samples were aliquoted and stored at −80 °C until they were analyzed for gene expression studies.
Dunnick J.K., Shockley K.R., Morgan D.L., Travlos G., Gerrish K.E., Ton T.V., Wilson R.E., Brar S.S., Brix A.E., Waidyanatha S., Mutlu E, & Pandiri A.R. (2019). Hepatic Transcriptomic Patterns in the Neonatal Rat after Pentabromodiphenyl ether (PBDE) Exposure. Toxicologic pathology, 48(2), 338-349.
+ Open protocol
+ Expand
5

Liver Tissue Sample Harvesting and RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rats were euthanized by CO2 gas. The liver was harvested and weighed, and then a representative section from the midline of the left lateral hepatic lobe was collected and fixed in 10% neutral buffered formalin for histology. Hematoxylin and eosin (H&E)-stained sections (5 μm) were examined by a board certified pathologist. Three samples (approximately 3–4 mm cubes) were dissected from the remaining left lateral hepatic lobe, and flash frozen in liquid nitrogen and stored at −80°C until RNA extraction. RNA was extracted from frozen samples using the Invitrogen PureLink Mini kit (Invitrogen cat# 12183-018A, Carlsbad, CA) according to the manufacturer's protocol. RNA concentration and quality were measured on a Bioanalyzer (Agilent Technologies, Santa Clara, CA). Samples were aliquoted and stored at −80°C until they were analyzed for gene expression studies.
Dunnick J.K., Shockley K.R., Morgan D.L., Brix A., Travlos G.S., Gerrish K., Sanders J.M., Ton T.V, & Pandiri A.R. (2016). Hepatic Transcriptomic Alterations for N,N-Dimethyl-p-toluidine (DMPT) and p-Toluidine after 5-day Exposure in Rats. Archives of toxicology, 91(4), 1685-1696.
+ Open protocol
+ Expand
6

Quantifying P2 Receptor Gene Expression in Polarized PDECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To investigate the expression of P2 receptor genes, total RNA was isolated from polarized PDEC with PureLink® mini kit (Invitrogen). First-strand cDNA of PDEC was synthesized using the High Capacity Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Dog brain cDNA (Cat. No. C1734035) was purchased from Amsbio (Cambridge, MA). cDNAs were then subjected to polymerase chain reaction (PCR). Primer-pair sequences for P2 receptor subtypes and the expected size of PCR products are described in Table 1. Real-time PCR was performed with a StepOnePlus Real-Time PCR System (Agilent Technologies Inc., Santa Clara, CA) using PerfeCTa SYBR Green FastMix (Quanta Biosciences, Gaithersburg, MD) and the thermocycler conditions recommended by the manufacturer. Relative gene expression was calculated by the ΔΔCt method using GAPDH as an internal control. Melting curve analysis showed a single sharp peak with the expected melting temperature (Tm) for all samples.
Seo J.B., Jung S.R., Hille B, & Koh D.S. (2016). Extracellular ATP protects pancreatic duct epithelial cells from alcohol-induced damage through P2Y1 receptor-cAMP signal pathway. Cell biology and toxicology, 32(3), 229-247.
+ Open protocol
+ Expand
7

Differential Gene Expression Analysis in SW1116 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from SW1116-shAGO2#1 and SW1116-shCON cells was purified using an Invitrogen PureLink mini kit. Libraries were prepared using the Illumina TruSeq RNA Sample Prep Kit as described by the manufacturer’s protocol. Samples were sequenced on the Illumina HiSeq 2000. Adapters and low-quality sequences were removed to obtain clean data by OAPnuke. The clean data were mapped to the human genome (hg38) using HISAT2 assembled by StringTie. Differentially expressed genes were calculated by the Ballgown package in R. Genes with RPKM (reads per kilobase per million mapped reads) values less than 1 in all samples were removed. Of the 17,007 genes identified in all samples, 245 (fold change ≥ 2 and p-value ≤ 0.001) genes were differentially expressed in SW1116-shAGO2#1 cell compared with their SW1116-shCON counterpart, which were listed in supplementary data.
Liu X., Meng X., Peng X., Yao Q., Zhu F., Ding Z., Sun H., Liu X., Li D., Lu Y., Tang H., Li B, & Peng Z. (2021). Impaired AGO2/miR-185-3p/NRP1 axis promotes colorectal cancer metastasis. Cell Death & Disease, 12(4), 390.
+ Open protocol
+ Expand
8

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRizol reagent (Thermo Fisher Scientific) and PureLink mini kit (Invitrogen). The purity and integrity of the isolated RNA were determined using a spectrophotometer NanoDrop One/One (Thermo Fisher Scientific). cDNA synthesis was performed using Protoscript first strand cDNA synthesis kit (New England Biolabs) and random hexamers according to the manufacturer’s instructions. iTaq™ Universal SYBR® Green Supermix (Bio-rad) was used for qPCR and the detection was performed in a Mastercycler® RealPlex2 (Eppendorf). Gene expression was normalized against the expression of β-Actin using the Relative Standard Curve Method. Results were expressed as the Mean ± SE (standard error) from three different replicates. The primers used in this study are listed in Supplementary Table 4.
Drosos Y., Escobar D., Chiang M.Y., Roys K., Valentine V., Valentine M.B., Rehg J.E., Sahai V., Begley L.A., Ye J., Paul L., McKinnon P.J, & Sosa-Pineda B. (2017). ATM-deficiency increases genomic instability and metastatic potential in a mouse model of pancreatic cancer. Scientific Reports, 7, 11144.
+ Open protocol
+ Expand
9

Quantifying PIM-3 Expression in Frozen Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
The tissues were snap frozen in liquid nitrogen and stored at −70° until RNA extraction. The tissue total RNA was extracted using a PureLink™ Mini Kit from the Invitrogen Corporation, following the manufacturer’s instructions. RNA concentration and OD260/OD280 ratio were measured with an Eppendorf biophotometer, then the total RNA was used for the first-strand cDNA synthesis with 2×NI-RT Master Mix. The RT-PCR primers were designed following the general rules and synthesized by Invitrogen Biotechnology Corporation in Shanghai. The primer sequence for PIM-3 was Forward: AAGGACGAAAATCTGCTTGTGG and Reverse: CGAAGTCGGTGTAGTCCGTG, respectively, and the PCR product was 100 base pairs. The primer sequence for reference gene GAPDH was Forward: GGAGCGAGATCCCTCCAAAAT and Reverse: GGCTGTTGTCATACTTCTCATGG, respectively, and the PCR product was 197 base pairs. Comparative CT method was used for analysis of Q-PCR data [10 (link)].
Qu Y., Zhang C., Du E., Wang A., Yang Y., Guo J., Wang A., Zhang Z, & Xu Y. (2016). Pim-3 is a Critical Risk Factor in Development and Prognosis of Prostate Cancer. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 22, 4254-4260.
+ Open protocol
+ Expand
10

RNA Extraction from Frozen Liver

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from frozen liver samples (approximately 3–4 mm cubes) from the PND 22 left lateral hepatic lobe, using the Invitrogen PureLink Mini kit (Invitrogen cat# 12183-018A, Carlsbad, CA) according to the manufacturer’s protocol. RNA concentration and quality were measured on a Bioanalyzer (Agilent Technologies, Santa Clara, CA). Samples were aliquoted and stored at − 80 °C until they were analyzed for gene expression studies.
Dunnick J.K., Shockley K.R., Pandiri A.R., Kissling G.E., Gerrish K.E., Ton T.V., Wilson R.E., Brar S.S., Brix A.E., Waidyanatha S., Mutlu E, & Morgan D.L. (2018). PBDE-47 and PBDE mixture (DE-71) toxicities and liver transcriptomic changes at PND 22 after in utero/postnatal exposure in the rat. Archives of toxicology, 92(11), 3415-3433.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!