Total RNA was extracted from the cultures using Trizol (Invitrogen) followed by chloroform extraction as manufacturer’s instructions. This was followed by DNase-1 (Qiagen) treatment followed by RNA cleanup using Qiagen RNA mini cleanup kit. cDNA was reverse transcribed using Superscript III RT kit (Invitrogen) as per the manufacturer’s instructions. PCR was performed using the primers listed in the Supplementary Table and values were normalized to β-actin.
Rna mini cleanup kit
Manufactured by Qiagen
The RNA mini cleanup kit is a laboratory instrument designed for the purification and cleanup of RNA samples. It efficiently removes contaminants and impurities from RNA extracts, preparing them for further analysis or downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Qiagen (2 mentions)
Superscript 3 rt kit, by Thermo Fisher Scientific (1 mentions)
Superscript 2 rt kit, by Thermo Fisher Scientific (1 mentions)
Dna engine opticon 2 system, by Bio-Rad (1 mentions)
Itaq universal sybr green, by Bio-Rad (1 mentions)
2 protocols using rna mini cleanup kit
1
Total RNA Extraction and cDNA Synthesis
2
Quantitative RT-PCR Analysis of Neural Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultures using TriZol (Invitrogen) followed by chloroform extraction, DNase-1 (Qiagen, Waltham, MA) treatment followed by the Qiagen RNA mini cleanup kit. cDNA was reverse transcribed using Superscript II RT kit (Invitrogen) as per manufacturer's instructions. qPCR was performed for Hes5, Hes1, Pax6, Brn3b, and Recoverin using iTaq Universal Sybr Green (Bio-Rad) performed on the DNA Engine Opticon2 System (Bio-Rad, Hercules, CA) according to the protocol below: cycle 1: 95°C for 3 minutes, 1 repeat, cycle 2: 96°C for 10 seconds and 59°C for 60 seconds (data collection), 40 repeats; and results were normalized to β-actin levels. Results were normalized to β-actin levels. The following primer sequences were used: HES5-F: CTCAGCCCCAAAGAGAAAAA; HES5-R: GCTTAGCAGATCCTTGCTCCAT; HES1-F: ATGGAGAAAAATTCCTCGTCCC; HES1-R: TTCAGAGCATCCAAAATCAGTGT; PAX6-F: TCTAATCGAAGGGCCAAATG; PAX6-R: TGTGAGGGCTGTGTCTGTTC; BRN3B (POU4F2)-F: CTCGCTCGAAGCCTACTTTG; BRN3B (POU4F2)-R: GACGCGCACCACGTTTTTC; RCVRN-F: GCAGAGGTCCTATCCCATGA; RCVRN-R: AGTCATTGGAGGTGACATCG; β-actin-F: AGGCACCAGGGGCGTGAT; and β-actin-R: GCCCACATAGGAATCCTTCTGAC. All of the primers were designed for an amplicon length of between 70 and 170 base pairs.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!