Fifty million mid-log LiSIR2rp1 sKO promastigotes were transfected with a Nucleofector II Device (Amaxa) using approximately 5 μg of each pSPαBLASTαLiSIR2RP1 plasmid and the Human T-Cell Nucleofector kit (Lonza). Following electroporation, parasites were incubated at 26°C for 24 h in complete SDM medium. Blasticidin was added to the cultures at 30 μg/mL and parasites were subcultured under drug pressure for 5 weeks before being used in experiments.
Nucleofector 2 device
Manufactured by Lonza
Sourced in Switzerland, Germany, United States, United Kingdom
The Nucleofector II device is a laboratory instrument designed for the electroporation-based transfection of cells. It facilitates the introduction of DNA, RNA, or other molecules into a variety of cell types, including hard-to-transfect cells. The device provides a controlled electrical pulse to enable the temporary permeabilization of the cell membrane, allowing the efficient delivery of the desired cargo into the cells.
Automatically generated - may contain errors
Lab products found in correlation
Amaxa cell line nucleofector kit 5, by Lonza (9 mentions)
Cell line nucleofector kit 5, by Lonza (8 mentions)
Human t cell nucleofector kit, by Lonza (5 mentions)
Human monocyte nucleofector kit, by Lonza (5 mentions)
Pmaxgfp, by Lonza (4 mentions)
Nucleofector kit 5, by Lonza (3 mentions)
Dmem f12, by Merck Group (3 mentions)
Amaxa rat nsc nucleofector kit, by Lonza (3 mentions)
Imem medium, by Lonza (3 mentions)
Anti cd3, by BD (3 mentions)
Amaxa cell line nucleofector kit c, by Lonza (3 mentions)
On targetplus non targeting pool, by Horizon Discovery (3 mentions)
Polyethylenimine (pei), by Polysciences (3 mentions)
Cell line nucleofector kit 5 reagent kit, by Lonza (2 mentions)
Nucleofector solution 5, by Lonza (2 mentions)
Pmaxgfp vector, by Lonza (2 mentions)
Axio oberver d1 microscope, by Zeiss (2 mentions)
Amaxa cell line nucleofector kit r, by Lonza (2 mentions)
P3 buffer, by Lonza (2 mentions)
Amaxa nhdf nucleofector kit, by Lonza (2 mentions)
119 protocols using nucleofector 2 device
1
Genetic Manipulation of Leishmania SIR2RP1
2
NHEJ Repair Assay in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A NHEJ repair assay was performed in A549 cells stably transfected with NHEJ reporter constructs as described previously [44 (link), 45 (link)]. In brief, cells were transiently transfected with 1 μg of the p-I-SceI expression vector by electroporation using an Amaxa nucleofector II device. Twenty-four h after transfection, confluent cells were treated with inhibitors. After an additional 24 h, cells were harvested, and the percentage of GFP positive cells was determined using a flow cytometer.
3
Generation of Transgenic BHK-21 and IBRS-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Baby hamster kidney cells (BHK-21, China Center For Type Culture Collection) and swine kidney cells (IBRS-2, China Center For Type Culture Collection) were used in the antiviral assays. All of the cell lines were cultured in HyClone DMEM with 10% HyClone fetal bovine serum in a 37 °C incubator with 5% CO2.
The vectors p3DEN2B and pEN were linearized by Pvu I. The fragment containing the shRNA, EGFP, and NEO expression sequences from p3DEN2B and the EGFP and NEO sequences from the pEN expressive sequence were purified and concentrated; 1 μg/μL of the concentrated linearization plasmid was transfected into the BHK-21 and IBRS-2 cells, respectively, using the Amaxa Nucleofector™ II Device. The transfected cells were revived in selected culture medium with G418; after one week, we harvested the NEO-positive cells. The cells were digested with trypsin and resuspended in the culture medium without fetal bovine serum. Then, the cells with the strongest GFP expression were sorted by the Beckman MoFlo™ XDP Flow Cytometer. The GFP-expressing cells were revived in culture medium with 10% fetal bovine serum; we detected the GFP expression using a fluorescence microscope and ascertained that the cells were all transgene positive. All four types of transgenic cells were frozen in a freezing medium (DMSO:fetal bovine serum:DMEM = 1:3:6) and stored in liquid nitrogen.
The vectors p3DEN2B and pEN were linearized by Pvu I. The fragment containing the shRNA, EGFP, and NEO expression sequences from p3DEN2B and the EGFP and NEO sequences from the pEN expressive sequence were purified and concentrated; 1 μg/μL of the concentrated linearization plasmid was transfected into the BHK-21 and IBRS-2 cells, respectively, using the Amaxa Nucleofector™ II Device. The transfected cells were revived in selected culture medium with G418; after one week, we harvested the NEO-positive cells. The cells were digested with trypsin and resuspended in the culture medium without fetal bovine serum. Then, the cells with the strongest GFP expression were sorted by the Beckman MoFlo™ XDP Flow Cytometer. The GFP-expressing cells were revived in culture medium with 10% fetal bovine serum; we detected the GFP expression using a fluorescence microscope and ascertained that the cells were all transgene positive. All four types of transgenic cells were frozen in a freezing medium (DMSO:fetal bovine serum:DMEM = 1:3:6) and stored in liquid nitrogen.
4
Generating Hybrid OvCa433Ncad+ Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
OvCa433 cells (Ecad+) were transfected with the Ncad expression vector to generate the hybrid OvCa433Ecad+/Ncad+ cell line (hereafter referred to as OvCa433Ncad+) by inserting a pmCherry:Ncad plasmid via electroporation utilizing the Human Keratinocyte Nucleofector kit and Nucleofector II device (Amaxa). Successfully transfected cell populations were observed under Olympus DSU-IX81 spinning disk confocal microscope, selected with OvCa433 medium containing 600 μl/ml of G418 (Geneticin; ThermoFisher Scientific), and further sorted with BD FACSAria III cell sorter every 4 to 5 passages. Freshly sorted cells were utilized for all experiments.
5
Nucleofection-mediated shRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All transfections were done using a Nucleofector II device and the Nucleofector V kit (Amaxa Biosystems). EPC cells were transfected using program T-030 and TE cells were transfected using program X-001. 106 cells were transfected per reaction in 100 μL of nucleofection buffer with the addition of 1 μg of shRNA. Cells were collected 48 hours post-nucleofection for Western blot and invasion assay analysis.
6
Efficient Nucleofection of Retinal Pigment Epithelial Cells
7
PIGN Knockdown and CRISPR/Cas9 Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAi-mediated PIGN knockdown experiments were conducted using the Nucleofector™ II Device (Amaxa) in conjunction with the Cell line Nucleofector™ Kit V reagent kit (Amaxa). CRISPR/Cas9 experiments were conducted according to a modified LentiCRISPRv2 (Addgene plasmid #49535) protocol [55 (link)]. The gRNA (AAACGGTCATGTAGCTCTGATAGC) we employed targets PIGN at exon 4 and results in a frameshift [21 (link)].
8
Somatic Nuclear Transfer in Swine Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The linearized p3DEN2B construct (the same with the constuct used in cell lines) was transfected into the swine fibroblast cell line using the Amaxa Nucleofector™ II Device. The transfected fibroblasts were cultured and passaged in selected culture medium with G418 (400 µg/mL, Promega) for fourteen days. The antibiotic-resistant colonies were selected and identified by PCR to confirm that the p3DEN2B vector had been inserted. The fibroblasts containing the vector were used as the nuclear donors in the somatic nuclear transfer (SCNT) procedure. SCNT was performed as previously described66 (link) (Fig. 2 ).
9
Jag1 Silencing in CLL Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CLL cells were transfected using the Amaxa nucleofection technology (Amaxa, Cologne, Germany) and the ON-TARGETplus SMARTpool small interfering RNA (siRNA) to Jag1 (siJag1) or ON-TARGETplus siCONTROL nontargeting pool (siCtrl) as negative control (Dharmacon, Lafayette, CO, USA). CLL cells (12 × 106) were resuspended in 100 µl Cell Line Solution Kit V (Lonza Group Ltd, Basel, Switzerland) with 0.25 μM of siJag1 or siCtrl, transferred to the provided cuvettes and transfected with the Amaxa Nucleofector II device (program U-013). Cells were immediately transferred into 12-well plates in complete medium and cultured for 72 h in the presence of 25 ng/ml IL-4. Cells were then examined for Jag1 protein expression to verify the efficiency of silencing, and for cell viability/apoptosis.
10
Depletion of DNA Repair Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For depletion of CtIP, RAD52 and RAD51, a pool of three siRNAs, specific for each protein, as previously described (Kostyrko et al., 2017 (link)) (Eurogentec), was introduced by electroporation (Nucleofector™ II device, Amaxa Biosystems) following manufacturer’s protocol and program U-23. Briefly, the following oligonucleotides were used for depletion of CtIP: 5′-GUGCAAGGUUUACAAAUAA-3′; 5′-CAAAGUCCCUGCCAAACAA-3′; 5′-AGAAUACUCUCCAGGAAGA-3′ (Eurogentec). Similarly, for downregulation of RAD52, again a cocktail of three specific RNAs was utilized, following the same transfection procedure: 5′-UGAGAUGUUUGGUUACAAU-3′; 5′-ACUGCAUUCUGGACAAAGA-3′; 5′-CCCUGAAGACAACCUUGAA-3′. For efficient RAD51 ablation the following three specific siRNA sequences were used: 5′-GUGCCAAUGAUGUGAAGAA-3′; 5′-GGGAAUUAGUGAAGCCAAA-3′; 5′-GGCGUUCAGAAAUCAUACA-3′. The following negative control RNA (ncRNA) sequence was used: 5′-UUCUCCGAACGUGUCACGUdTdT-3′. ncRNA is used for mock-transfection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!