Gotaq flexi buffer

16Sr genes were amplified by PCR with universal bacterial primers 341FGC (5′-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3′) and 518R (5′-ATTACCGCGGCTGCTGG-3′) [79 (link)]. A mastermix containing 2 µL of purified DNA (145–371 ng/µL), 0.2 mM dNTPs, 1× GoTaq^® Flexi buffer (Promega, Madison, WI, USA), 1.5 mM MgCl₂, 0.025 Units GoTaq^® Flexi Polymerase, 20 pM each of the forward and reverse primers, 341FGC and 518R respectively, and sterile water was prepared for PCR amplification. The thermocycling program consisted of 1 cycle of 5 min at 95 °C; 30 cycles of 1 min at 95 °C, 1 min at 65 °C, 1.5 min at 72 °C; and a final extension at 72 °C for 10 min [80 (link)].

The partial SSU rRNA gene sequence was amplified from each isolate using 50 μL PCR reactions with a final concentrations of 1X Go Taq Flexi Buffer (Promega Corporation, Madison, WI, USA), 5 mmol/L MgCl₂, 200umol/L dNTPs, 200 nmol/L 360F (5′‐CGGAGARGGMGCMTGAGA‐3′), and 200 nmol/L EukB (5′‐TGATCCTTCTGCAGGTTCACCTAC‐3′) and 1 unit Taq Polymerase. The PCR reaction consisted of 98°C for 30 sec, followed by 30 repetitions of 98°C for 10 sec, 55°C for 15 sec, and 72°C for 30 sec, followed by a final extension step of 72°C for 7 min. Timing did not allow for SSU rRNA amplifications for the Washington isolates. The D1/D2 region of the eukaryotic LSU rRNA (26S) gene was also amplified, using the same protocol as noted above, with the forward primer NL1 (5′‐TGCTGGAGCCATGGATC‐3′) and reverse primer NL4 (5′‐TAGATACATGGCGCAGTC‐3′). The PCR protocol utilized a 94°C 30 sec initial denaturing step, followed by 30 cycles: 94°C for 30 sec, 52°C for 30 sec, 72°C for 1 min, and a final extension temperature of 72°C for 7 min. PCR products were mixed with gel loading buffer (Ambion), in a 5 to 1 ratio, and were run on a 1% agarose gel with 1X Sybr Safe DNA Gel Stain (Thermo Fisher Scientific, Waltham, MA, USA) along with a 1 kb ladder (Invitrogen, Carlsbad, CA, USA) to confirm the correct size of the amplified PCR product.

Nested-PCR was performed to amplify the coding region of the GRA6 gene according to Zakimi et al. (2006) (link), and to verify the presence of T. gondii DNA in the meat samples. PCR amplification was performed with 2 μl of DNA template in a 50 μl reaction mixture containing 5× green GoTaq Flexi buffer (Promega, cat. # M891A, Wisconsin, USA), 2.0 mM MgCl₂ (Promega, cat. # M890A, Wisconsin, USA), 200 μM of each of the four deoxynucleotide triphosphates (dNTP) (Promega, cat. # C1141, Wisconsin, USA), 50 pmol of each primer (Sigma, Oakville, ON), and 1.25 U of Go Taq Hot Start Polymerase (Promega, cat. # M5005, Wisconsin, USA). The PCR primer pair, GRA6-FO and GRA6-RO, was designed from the GRA6 gene sequence and used in the primary PCR (Table 1). Two microliter of 1:10 diluted primary PCR product was used as a template in the secondary PCR using the internal primers described by Fazaeli et al. (2000) (link), designated GRA6-F and GRA6-R (Table 1).

The complete gene located in Chr 14 was amplified using primers reported by Mehrizi (Mehrizi et al., 2017 (link)). PCR reactions were modified to use 100 ng of total DNA and 0.4 mM of each primer, 0.25 mM dNTPs, (Invitrogen, Carlsbad, CA,USA) 1X GoTaq Flexi buffer, 1.5 mM MgCl2 for 1.5 U of GoTaq Flexi DNA polymerase (Promega Madison WI, USA). Reaction conditions were as follows: 95°C for 3 min followed by 35 cycles of 95°C for 30 s, 57°C for 50 s, and 72°C for 60 s; these were held at 72°C for 5 min.

Infected roots were homogenized using a FastPrep‐24™ 5G (Biomedicals) at 6.0 m/s for 40 s. DNA was extracted using the DNeasy Plant Mini Kit according to the manufacturers’ instructions (Quiagen). DNA extracts were stored at −20°C until further use. The primers used were s4f (5′‐GGCAGCAGGYGYGHAAATIRYCCA‐3′) and C9rPhyt (5′‐GGAATTCCTCGTTGGTGCG‐3′) (Hittorf et al., 2020 (link)). Each PCR mix (29.3 μl) included final concentrations of 0.2 mM dNTP mix (Fermentas), 1 μM of each primer, 3 mM MgCl2 (Promega), 1× GoTaq flexi buffer (Promega), 2 mg/ml BSA (Sigma‐Aldrich) and 0.25 U GoTaq DNA polymerase (Promega). 2 μl DNA extract was used for each reaction and a negative control was included. PCR conditions were 95°C for 3 min, followed by 33 cycles of 95°C for 30 s, 65°C for 30 s and 72°C for 90 s. This was followed by a 10‐min final elongation step at 72°C. PCR products were visualized on a 1% agarose gel (Biozym Scientific GmbH) stained with 0.1 μl of SYBR Safe (Thermo Fisher Scientific) per 30 ml. PCR products were purified using a PEG purification (Neuhauser et al., 2014 (link)) and sent to Eurofins Genomics Sequencing GmbH for sequencing.

Genomic DNA was extracted from peripheral blood using the salting out method [27 (link)]. The ABCB1 C3435T polymorphism was analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay using the primer sequences 5′-TTGATGGCAAAGAAATAAAGC-3′ and 5′-CTTACATTAGGCAGTGACTCG-3′. The PCR reaction was performed in a total volume of 25 μl containing 100 ng of genomic DNA, 1× of 5× GoTaq Flexi Buffer (Promega), 1.25 mM MgCl2, 0.2 mM of each dNTP, 0.625 mM of each primer and 0.5U Go Taq DNA polymerase (Promega). PCR program consisted of an initial denaturation at 94 °C for 5 min followed by 35 cycles of 95 °C for 90 s, 55 °C for 60 s, 72 °C for 90 s, and a final extension at 72 °C for 7 min. Controls with known genotypes (homozygous wild-type, homozygous mutant, and heterozygous) were included in each PCR as a reference. PCR products were digested with 10 units of Mbo I restriction enzyme for 16 h. The digested products were separated by 3 % agarose gel electrophoresis after ethidium bromide staining and observed under UV light. The resulting fragments were 130 bp and 76 bp for the Wild-type homozygote CC, 206 bp, 130 bp and 76 bp for the heterozygote CT and 206 bp for Homozygote mutant variant TT.