Farred

Manufactured by Merck Group

FarRed is a specialized laboratory instrument designed for fluorescence detection and analysis. It operates in the far-red region of the visible light spectrum, enabling researchers to explore applications that require this specific wavelength range.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Duolink® In Situ Detection Reagents FarRed PLA Duolink® FarRed

8 protocols using farred

Cytotoxicity and Cytokine Assay of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cytotoxicity of T cells was determined by incubating corresponding T cells with 0.5µM CellTrace FarRed (Invitrogen, C34564)-labeled target cells (PG, SKOV3, MDA-MB-231 or MDA-MB-231-H3KO) at the indicated effector:target (E:T) ratios for 12 h. Then, 0.01mg/mL DAPI (Sigma-Aldrich, D8417) were added to each reaction, and the cells were immediately analyzed by flow cytometry within 10 s. The % cell lysis was calculated as follows: [(FarRed+ DAPI+ cells – spontaneous apoptosis)/total FarRed+ cells] × 100%.
Cytokine-releasing assays were performed by co-culturing 1 × 10⁶ T cells with 5 × 10⁵ irradiated (100 Gy) target cells at a 2:1 ratio. The supernatants from each coculture reaction were collected 24 h later. Cytokine levels of IL-2, IL-4, IL-6, IL-10, IFN-gamma, and TNF-α in the supernatants were determined using the Human Th1/Th2 Cytokine Kit II (BD Biosciences) in accordance with the manufacturer’s instructions.

Huang B., Luo L., Wang J., He B., Feng R., Xian N., Zhang Q., Chen L, & Huang G. (2019). B7-H3 specific T cells with chimeric antigen receptor and decoy PD-1 receptors eradicate established solid human tumors in mouse models. Oncoimmunology, 9(1), 1684127.

+ Open protocol

+ Expand

Detecting EBNA1-NCL Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were fixed in 1× PBS, 4% paraformaldehyde for 20 min and permeabilized for 10 min with 0.4% Triton X-100, 0.05% CHAPS. The EBNA1–digoxigenin probe mRNA (5′-CTTTCCAAACCACCCTCCTTTTTTGCGCCTGCCTCCATCAAAAA-3′) at 50 ng/well was denaturated for 5 min at 80°C. The probe hybridization reaction was carried out in 40 μl of hybridization buffer (10% formamide, 2× SCC, 0.2 mg/ml E. coli tRNA, 0.2 mg/ml salmon sperm DNA and 2 mg/ml BSA). The fixed cells were washed and blocked into the blocking solution (1× PBS, 3% BSA, 0.1% saponin) before incubation with the primary antibodies (anti-digoxigenin, Sigma 1/200 and anti-NCL, Abcam 1/1000). The PLA reaction was performed under the manufacturer’s protocol using the Duolink PLA in situ kit, PLA probe anti-rabbit plus, PLA probe anti-mouse Minus and the in situ detection reagent FarRed, all from Sigma. The results were analysed using a Zeiss Axio Imager M2. All the PLA experiments were performed at least three times independently, and the following controls probes were implemented: without mRNA probe or without primary antibodies.

Angrand G., Quillévéré A., Loaëc N., Dinh V.T., Le Sénéchal R., Chennoufi R., Duchambon P., Keruzoré M., Martins R.P., Teulade-Fichou M.P., Fåhraeus R, & Blondel M. (2022). Type I arginine methyltransferases are intervention points to unveil the oncogenic Epstein-Barr virus to the immune system. Nucleic Acids Research, 50(20), 11799-11819.

+ Open protocol

+ Expand

Quantifying KEAP1-NRF2 Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

H1975 cells were seeded on 12-well plates containing 12-mm coverslips for 24 h before drug treatment. After 30 min or 24 h of drug treatment, the cells were washed twice with PBS Ca²⁺ Mg²⁺ and fixed with paraformaldehyde 4%, followed by PLA. The protocol of PLA was according to Chen and Huang [57 (link)]. Primary antibodies KEAP1 monoclonal antibody (1F10B6, Invitrogen) and NRF2 polyclonal antibody (ab31163, Abcam) were used at a dilution of 1:800. The secondary antibodies attaching probes were provided from the kit Duolink In Situ PLA Probe Anti-Rabbit MINUS (DUO92006, Sigma-Aldrich) and Probe Anti-Mouse PLUS (DUO92001, Sigma-Aldrich). The protein-protein interactions (PPIs) were detected with detection reagent FarRed (DUO92013, Sigma-Aldrich). Phalloidin-Alexa 488 nm and DAPI were used to visualize the cytoplasm and nucleus, respectively. Images were taken by using a spinning disk confocal microscopic system with a magnification of 60× objective. Total number of blobs was calculated as Z-projection via Metamorph software. A student’s t-test was applied to compare the difference between the control and each treatment group.

Hsu J.H., Chang P.M., Cheng T.S., Kuo Y.L., Wu A.T., Tran T.H., Yang Y.H., Chen J.M., Tsai Y.C., Chu Y.S., Huang T.H., Huang C.Y, & Lai J.M. (2019). Identification of Withaferin A as a Potential Candidate for Anti-Cancer Therapy in Non-Small Cell Lung Cancer. Cancers, 11(7), 1003.

+ Open protocol

+ Expand

Duolink PLA Assay for Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Duolink PLA assay^{56 (link)} was performed using Duolink in situ PLUS and MINUS probes and Duolink in situ detection reagents FarRed according to manufacturer’s instructions (Sigma-Aldrich). At the end of the procedure the slides were mounted with a coverslip using Duolink^® In Situ Mounting Medium which contains 4,6-Diamidino-2-phenylindole, dihydrochloride (DAPI) for nuclear staining. Imaging was performed by fluorescence or confocal microscopy as above. Duolink signal appears as dots.

Lindenboim L., Grozki D., Amsalem-Zafran A.R., Peña-Blanco A., Gundersen G.G., Borner C., Hodzic D., Garcia-Sáez A.J., Worman H.J, & Stein R. (2020). Apoptotic stress induces Bax-dependent, caspase-independent redistribution of LINC complex nesprins. Cell Death Discovery, 6, 90.

+ Open protocol

+ Expand

Visualization of EBNA1-NCL Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were fixed with 4% paraformaldehyde in PBS 1X for 20 min and permeabilized with 0.4% Triton X-100, 0.05% CHAPS for 5 min at room temperature. A quantity of 50 ng of EBNA1-digoxigenin mRNA probe (5′ CTTTCCAAACCACCCTCCTTTTTTGCGCCTGCCTCCATCAAAAA 3′) or control sense probe was denaturated 5 min at 80 °C and the hybridization reaction was carried out overnight at 37 °C in 40 μl hybridization buffer (10% formamide; 2X SSC, 0.2 mg ml^–1E. coli tRNAs, 0.2 mg ml^–1 sheared salmon sperm DNA and 2 mg ml^–1 BSA. A blocking solution of 3% BSA 0.1% saponine in 1X PBS was added for 30 min followed by 2 h incubation at room temperature with the primary antibodies (anti-digoxigenin 1/200 -Sigma- and anti-NCL 1/1000 -Abcam-) diluted in PBS 1X, 0.3% BSA, 0.1% saponine. The PLA was carried out using the Duolink PLA in situ kit, PLA probe anti-rabbit plus, the Duolink in situ PLA probe anti-mouse MINUS and the in situ detection reagent FarRed (all from Sigma) following the manufacturer’s protocol. PLA results were visualized using a Zeiss LSM780 confocal microscope. All the PLA experiments were performed at least three times independently and, each time, PLA dots were counted in 50–100 cells. For each PLA experiment, the following controls were used: w/o mRNA probe, w/o antibodies and with the control sense probe.

Lista M.J., Martins R.P., Billant O., Contesse M.A., Findakly S., Pochard P., Daskalogianni C., Beauvineau C., Guetta C., Jamin C., Teulade-Fichou M.P., Fåhraeus R., Voisset C, & Blondel M. (2017). Nucleolin directly mediates Epstein-Barr virus immune evasion through binding to G-quadruplexes of EBNA1 mRNA. Nature Communications, 8, 16043.

+ Open protocol

+ Expand

Exosome Uptake and Binding Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exosomes from control or SYTO-RNA-labeled HSC or that contained Cy3-miR-199a-5p were labeled for 1 hr with 4 μM of the fluorescent lipophilic membrane dyes PKH26 or PKH67, according the manufacturer’s specifications (Sigma-Aldrich). Exosomes (0- 4 μg/ml) or free Cy3-labeled miR-199a-5p (1 μM) were added for up to 48 hrs to primary mouse HSC or hepatocytes which were then washed in PBS and imaged using a confocal microscope (Zeiss, Obercochen, Germany) or lysed in lysis buffer (Boston Bioproducts, Ashland, MA) and measured at 590/540 nm using a Spectra Max® M2 microplate reader (VWR, Atlanta, GA) to assess levels of PKH26 flourescence. Prior to exosome addition in some experiments, HSC were stained with PKH67 (Sigma-Aldrich) and hepatocytes were stained with far red (Sigma-Aldrich). In some binding experiments, HSC were pre-treated or co-incubated with 0-100 μg/ml RGD or RGE tripeptides (American Peptide, Sunnyvale CA), 0-100 μM EDTA (Sigma-Aldrich), 0-10 μM sodium chlorate (Sigma-Aldrich), 0-10 μM sodium sulfate (Sigma-Aldrich), 0-10 μg/ml rabbit anti-mouse integrin αvβ3 IgG (Bioss Inc, Woburn, MA), or 0-20 μg/ml rat anti-mouse integrin α5β1 IgG (Millipore, Temecula, CA) or 0-10 μg/ml rat anti-mouse integrin αM, (CD11b; Novus Biologicals Littleton CO). For antibody studies, non-immune IgG was used as a negative control.

Chen L, & Brigstock D.R. (2016). Integrins and heparan sulfate proteoglycans on hepatic stellate cells (HSC) are novel receptors for HSC-derived exosomes. FEBS letters, 590(23), 4263-4274.

+ Open protocol

+ Expand

Visualizing Mitochondria-Lysosome Contacts

Check if the same lab product or an alternative is used in the 5 most similar protocols

NK cells were stained with mouse anti–voltage-dependent anion-selective channel (VDAC1) (ab14734, Abcam) and rabbit anti-Rab7 (D95F2, Cell Signaling Technology) Abs to visualize mitochondria–lysosome contact sites. The Duolink proximity ligation assay (PLA) kit (Sigma-Aldrich) was used, in conjunction with the Duolink PLA probe anti-mouse MINUS and anti-rabbit PLUS, and the Duolink detection reagent FarRed (Sigma-Aldrich) following the manufacturer’s recommendations. Fluorescent PLA signal was detected via confocal microscopy. The PLA signal was quantified as spot count per cell (nucleus) using Fiji software.

Clement D., Szabo E.K., Krokeide S.Z., Wiiger M.T., Vincenti M., Palacios D., Chang Y.T., Grimm C., Patel S., Stenmark H., Brech A., Majhi R.K, & Malmberg K.J. (2023). The Lysosomal Calcium Channel TRPML1 Maintains Mitochondrial Fitness in NK Cells through Interorganelle Cross-Talk. The Journal of Immunology Author Choice, 211(9), 1348-1358.

+ Open protocol

+ Expand

Visualizing Mitochondria-Lysosome Contacts

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!