Turbo dna free reagent

Total RNA was isolated from GM using TRIzol reagent (Molecular Research Center, Inc) and treated with Turbo DNA-free reagent (Ambion) to reduce DNA contamination. Total RNA concentrations were measured and assessed for purity using a NanoDrop One spectrophotometer (Thermo Fisher). Relative mRNA levels were determined by qPCR using One Step PCR Master Mix Reagents or Two Step PCR Master Mix for TaqMan analysis (Applied Biosystems) after cDNA synthesis by using High-Capacity cDNA Archive reagents (Applied Biosystems). miRNAs were reverse-transcribe using miRNA first-strand cDNA synthesis kit (QP018, Genecopoeia). Semi-quantification of miR-675-3p and miR-675-5p was performed using a miRNA q-PCR detection kit (QP016, Genecopoeia). U6 snRNA, TATA binding protein and Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNAs were measured as normalization controls. The mature mmu-miR-675-3p (cuguaugcccuaaccgcucagu) and -5p (uggugcggaaagggcccacagu) DNA sequences were used as the forward primers, and the universal adaptor PCR primers provided in the miRNA qRT-PCR detection kit (Genecopoeia) as the reverse primer. qPCR primers unless stated here were detected with TaqMan probes.

Total RNA was prepared from transfected HepAD38 cells or infected HepaRG cells using TRIzol reagent (Invitrogen) and TURBO DNA-free reagent (Ambion). RNA (500 ng) was retrotranscribed using random primers and RevertAid H Minus M-MuLV reverse transcriptase (Fermentas). cDNA was analyzed by quantitative PCR (qPCR) using SybrGreen PCR Master mix (Applied Biosystems) on ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) using standard PCR protocol (denaturation at 95°C and annealing/extension at 63°C), and a final dissociation step to ensure amplicon-specific detection. The primers used in RT-qPCR are listed in table 2. The primers HBV RT sense and HBV RT anti-sense amplify all HBV transcripts except the 0.8 kb transcript encoding HBx. Roth2 was used as a reference gene because of its low variation coefficient in human liver tumors and cell lines [31] (link). All assays were performed in triplicate using 0.5 µl of cDNA per reaction and mean values were calculated according to the ΔCT quantification method. Results are expressed as the average of at least three independent experiments. Standard deviations are indicated. Statistical differences were analyzed using the non-parametric Wilcoxon signed-rank test for paired data when more than five experiments were included in the analysis.

Total RNA was isolated from each cerebral cortex using Ambion RNAqueous according to the manufacturer’s protocol (Life Technologies, Grand Island, NY) and treated with Turbo DNA-free reagent (Ambion, Life Technologies, Austin, TX) to remove genomic DNA. RNA purity was assessed with native agarose gel electrophoresis and analysis of the 28S and 18S rRNA bands. RNA was of high purity, showed no degradation, and was free of DNA (Fig. S1).

Equal amounts of cell cultures, corresponding to 2x10⁵ cells, were collected at the appropriate time points following infection (hours post-infection, hpi) and processed by using the EZ1 viral nucleic acid kit on a EZ1 platform (Qiagen), following the manufacturer’s instructions, in order to obtain a total nucleic acid fraction, containing both viral DNA and RNA in elution volumes of 120 μL. Volumes of 10 μL were then used in the subsequent qPCR and qRT-PCR assays for the quantitative evaluation of target viral nucleic acids. For quantitative analysis of viral DNA, aliquots of the eluted nucleic acids were directly amplified in a qPCR assay. For quantitative analysis of viral RNA, corresponding aliquots were first treated with Turbo DNAfree reagent (Ambion) and then amplified in a qRT-PCR assay.

Strains were grown in TSB, supplemented with IPTG when specified, at 37°C with aeration until OD_600nm = 1. Cells were pelleted by centrifugation (2 min, 20,800 x g) and immediately frozen at -20°C. RNA extraction was then performed as previously described [66 (link)], followed by DNaseI treatment with the TURBO DNA-free reagent (Ambion, Austin, TX) in order to eliminate residual genomic DNA.

Brain regions including the prefrontal cortex (Pfc), striatum (Str), thalamus (Tha), hypothalamus (Hyp), hippocampus (Hip), brain stem (BS), periaqueductal gray (PAG), and cerebellum (Cb) were dissected on a mouse Plexiglas brain mold using the atlas of Paxinos and Franklin [43] as a reference. The spinal cord (Spc) from L1 to L5 and whole brain were also dissected. The dissected tissues were immediately homogenized in QiAzol Reagent (Qiagen). The homogenates were stored at −80°C until further RNA isolation. 2–3 mice were pooled for each region, and a total of 8–10 mice used for each strain. Total RNAs were extracted using miRNeasy kit (Qiagen) following manufacture protocol. RNA concentrations were determined using a Qubit 2.0 Fluorometer (Invitrogen). RNAs were first treated with Turbo-DNA free reagent (Ambion) following the manufacture’s protocol to remove potentially contaminating genomic DNA, and reverse transcribed with Superscript II reverse transcriptase (Invitrogen) and random hexmers. The first-strand cDNA was then used as templates in SYBR qPCRs.