Log In Sign up
The largest database of trusted experimental protocols

Rt2 sybr green

Manufactured by Qiagen
Visit Supplier
Sourced in United States

The RT2 SYBR Green is a laboratory equipment product designed for gene expression analysis. It is a real-time PCR (Reverse Transcription Polymerase Chain Reaction) reagent that utilizes the SYBR Green dye to detect and quantify target gene expression in samples.

Automatically generated - may contain errors

Lab products found in correlation

High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions) Rneasy plus mini kit, by Qiagen (4 mentions) Cfx96, by Bio-Rad (4 mentions) Rt2 first strand kit, by Qiagen (3 mentions) Rneasy mini kit, by Qiagen (3 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Random hexamer, by Promega (2 mentions) M mlv reverse transcriptase, by Promega (2 mentions) Quantitect reverse transcription kit, by Qiagen (2 mentions) Cfx96 thermocycler, by Bio-Rad (2 mentions) Taqman, by Thermo Fisher Scientific (2 mentions) Rt2 profiler pcr array, by Qiagen (2 mentions) Dna engine opticon 2 system, by Bio-Rad (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Rneasy column, by Qiagen (1 mentions) Powersybr, by Thermo Fisher Scientific (1 mentions) Quantstudio 7, by Thermo Fisher Scientific (1 mentions) Rnaeasy kit, by Qiagen (1 mentions) Iscript cdna kit, by Bio-Rad (1 mentions) Superscript 4 vilo, by Thermo Fisher Scientific (1 mentions)

23 protocols using rt2 sybr green

1

Profiling Differential Gene Expression in Msi1-Overexpressing Intestinal Epithelium

Check if the same lab product or an alternative is used in the 5 most similar protocols
Jejunum intestinal epithelium cells were isolated from mice 7 d after TAM administration. Total RNA was extracted using Trizol (Life Technologies, #15596-026) and purified on RNeasy columns (Qiagen, #74104). Then complementary DNA (cDNA) synthesis was performed using 1 µg purified total RNA and the RT2 First Strand Kit (Qiagen, #330401) following the manufacturer’s protocol. This kit included a gDNA elimination step. Prepared cDNA was mixed with the RT2 SYBR green (Qiagen, #330502) and dispensed in a 96-well RT2 Profiler PCR Array for the Mouse Cancer PathwayFinder (Qiagen, #330231 PAMM-033ZA) according to manufacturer’s recommendations. A single array was used for each individual mouse (three mice per genotype) and assayed in a DNA Engine Opticon 2 System (MJ Research). Target expression was analyzed using the ΔΔCt method and normalized to the average cycle threshold (Ct) values of the five housekeeping genes provided in the array. For the initial analysis, targets with an expression change greater or less than 25% of the control samples were considered to be differentially expressed in Msi1-overexpressing samples.
Chiremba T.T, & Neufeld K.L. (2021). Constitutive Musashi1 expression impairs mouse postnatal development and intestinal homeostasis. Molecular Biology of the Cell, 32(1), 28-44.
+ Open protocol
+ Expand
2

Comprehensive RNA Expression Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the RNAeasy kit (Qiagen) from all samples except for NHBEs, for which Direct-zol mini RNA isolation kit was used (Zymo Research). cDNA was synthesized from the total RNA with the RT2 (link) First Strand kit (Qiagen, for all cell lines except for SARS-CoV-2-infected cells), Superscript VILO IV (Thermo Fisher, for HNBEs), or iSCRIPT cDNA kit (BioRad, for organoids and SARS-CoV-2-infected cell lines), always with an additional DNase I treatment step. qRT-PCR assays were performed in technical duplicates in 96- or 384-well plates on QuantStudio 7 (Life Technologies) or Bio-Rad CFX 96 instrument, with RT2 SYBR Green (Qiagen), POWER SYBR (Thermo Fisher), iTaq SYBR (BioRad) or TaqMan (Thermo Fisher) expression assays (Supplementary Table 4). The expression of target genes was normalized by geometric means of endogenous controls (GAPDH, HPRT1, TBP or ACTB, as indicated in Supplementary Table 2A), and presented as dCt values relative to endogenous controls (log2 scale). For cell lines, the analyses were based on biological replicates for samples obtained from donors (NHBEs and organoids), 3–4 biological replicates were averaged and presented per each donor.
Onabajo O.O., Banday A.R., Stanifer M.L., Yan W., Obajemu A., Santer D.M., Florez-Vargas O., Piontkivska H., Vargas J.M., Ring T.J., Kee C., Doldan P., Tyrrell D.L., Mendoza J.L., Boulant S, & Prokunina-Olsson L. (2020). Interferons and viruses induce a novel truncated ACE2 isoform and not the full-length SARS-CoV-2 receptor. Nature genetics, 52(12), 1283-1293.
+ Open protocol
+ Expand
3

Transcriptional Analysis of TNIP1 Haplotypes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from EBV B cells carrying the non-risk or risk TNIP1 H1 haplotype was isolated using Direct-zol RNA MiniPrep Plus kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol (3 (link)). cDNA synthesis was performed using QuantiTect reverse transcriptase kit (Qiagen, Germantown, MD) as per the manufacturer’s recommendations. Gene expression was measured by real-time PCR analysis using RT2 SYBR Green (Qiagen). Gene expression primers for human ANXA6 (QT00066941), human DCTN4 (QT00038766), human GM2A (QT00071967), human SMIM3 (QT01028090), human TNIP1 (QT00044072), and human GAPDH (PPH00150F) were purchased from Qiagen.
Pasula S., Tessneer K.L., Fu Y., Gopalakrishnan J., Pelikan R.C., Kelly J.A., Wiley G.B., Wiley M.M, & Gaffney P.M. (2020). Risk Variants with Opposing Functional Effects Result in Hypomorphic Expression of TNIP1 and Other Genes within a 3D Chromatin Network. Arthritis & rheumatology (Hoboken, N.J.), 72(5), 780-790.
+ Open protocol
+ Expand
4

Quantification of Placental GLUT8 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from human placental samples using Direct-zol RNA MiniPrep Kit (Zymo Research, CA). First-strand cDNA was synthesized from 1 μg of total RNA using a qScript cDNA Synthesis Kit (Quanta Biosciences, MD). cDNA was used to perform RT-PCR using RT2 SYBR Green (Qiagen, CA) and GLUT8 primers (PPH13718A, Qiagen, CA). The cycling conditions consisted of 95°C for 10 minutes, followed by 40 cycles at 95°C for 30 seconds and 60°C for 1 minute. Relative quantification was used to calculate the difference between the target gene and the housekeeping gene 18S rRNA using the ΔCT method [33 (link)].
Janzen C., Lei M.Y., Jeong I.S., Ganguly A., Sullivan P., Paharkova V., Capodanno G., Nakamura H., Perry A., Shin B.C., Lee K.W, & Devaskar S.U. (2018). Humanin (HN) and glucose transporter 8 (GLUT8) in pregnancies complicated by intrauterine growth restriction. PLoS ONE, 13(3), e0193583.
+ Open protocol
+ Expand
5

RT-qPCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated as above. cDNA was synthesized using SuperScript III First-strand Synthesis kit (Invitrogen, Carlsbad, CA) and quantified using RT2 SYBRGreen (Qiagen, Valencia, CA). qRT-PCR was performed in an ABI7500 Real-Time PCR system (Applied Biosystems, Foster City, CA). Glyceraldehyde phosphate dehydrogenase (GAPDH) mRNA was used as an internal control. The ΔΔCt method was used for quantitation. Primer sequences are available upon request.
Michalovicz L.T., Lally B, & Konat G.W. (2015). Peripheral challenge with a viral mimic upregulates expression of the complement genes in the hippocampus. Journal of neuroimmunology, 285, 137-142.
+ Open protocol
+ Expand
6

miR218 Modulation of Cell Motility

Check if the same lab product or an alternative is used in the 5 most similar protocols
U‐118 MG cells treated with miR218 mimic were collected for total RNA isolation with ExtractME Total RNA Kit (Blirt) according to the manufacturer’s protocol. 900 ng of RNA was used in the reverse transcription procedure with RT2 Easy First Strand Kit (Qiagen). cDNA mixed with the RT2 SYBR Green was then evenly aliquoted onto the RT2 profiler plates: Human Cell Motility, and Human Extracellular Matrix and Adhesion Molecules (Qiagen). qRT‐PCRs were conducted in LightCycler®480 (Roche), and subsequently analysed by software provided online by Qiagen.
Grabowska M., Kuczyński K., Piwecka M., Rabiasz A., Zemła J., Głodowicz P., Wawrzyniak D., Lekka M, & Rolle K. (2022). miR‐218 affects the ECM composition and cell biomechanical properties of glioblastoma cells. Journal of Cellular and Molecular Medicine, 26(14), 3913-3930.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from flash-frozen cell pellets and tumour tissue (GenElute: Sigma-Aldrich, USA) and cDNA was generated with 500 ng RNA using a reverse transcription kit (Bio-Rad iScript: Qiagen, USA). RNA quantity and quality were assessed with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). All QPCRs were run on an ABI 7500 FAST machine (Applied Biosystems, USA) with a commercial mastermix (TAqMan: Applied Biosystems, USA; RT2 SYBR green: Qiagen, USA; or SsoFAST SYBR green: BioRad, USA). QPCR primers (Table S1) amplified single products of the expected size with a single-peak melt curve. Primers were further validated to ensure that primer efficiency was close to 100% and closely matched efficiency of housekeeping genes, with a dynamic range of at least three orders of magnitude. The QPCR-based RT2 profiler array was performed similarly, following the manufacturer’s protocol (Qiagen, USA).
Hodgkinson K., Forrest L.A., Vuong N., Garson K., Djordjevic B, & Vanderhyden B.C. (2018). GREB1 is an estrogen receptor-regulated tumour promoter that is frequently expressed in ovarian cancer. Oncogene, 37(44), 5873-5886.
+ Open protocol
+ Expand
8

Porcine Progenitor Cell Cytokine Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
To identify growth factors and cytokines expressed by undifferentiated and early myogenic differentiated pPICs, gene array analyses were performed (n = 3/group). RNA was extracted from pPICs that were either maintained in an undifferentiated condition in standard GM or placed in a myogenic permissive environment (DMEM/F12, 2% horse serum) for 24 h. Total RNA was isolated using the Qiagen RNeasy Mini Kit and reverse transcribed using the RT2 first strand kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations for the RT2 Profiler PCR Array. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was then performed using RT2 SYBR Green (Qiagen) and the RT2 Profiler PCR Array (Qiagen), which was custom designed for the identification of porcine growth factors and cytokines of interest. Briefly, samples were denatured for 10 min at 95°C, cycled 40 times at 95°C for 15 s, followed by 40 cycles at the annealing temperature of 60°C for 1 min on a MyIQ thermocycler (Bio-Rad, Hercules, California). All reactions were carried out in triplicate; data were normalized to 5 housekeeping genes (ACTB, B2M, GAPDH, HPRT1, RPL13A) and analyzed using Bio-Rad IQ software (version 3.1).
Lewis F.C., Cottle B.J., Shone V., Marazzi G., Sassoon D., Tseng C.C., Dankers P.Y., Chamuleau S.A., Nadal-Ginard B, & Ellison-Hughes G.M. (2017). Transplantation of Allogeneic PW1pos/Pax7neg Interstitial Cells Enhance Endogenous Repair of Injured Porcine Skeletal Muscle. JACC: Basic to Translational Science, 2(6), 717-736.
+ Open protocol
+ Expand
9

Quantification of hmox-1 and noxa mRNA in HL-60 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The quantification of both hmox-1 and noxa (PMAIP1) mRNA transcripts was carried out by real-time PCR protocols. The total RNA was extracted from HL-60 cells (1×106) treated with Pyr-1, bortezomib, or the vehicle control, 0.3% v/v PEG-400 for 6 h using the RNeasy Mini kit (Qiagen, 74104). cDNA synthesis was performed by using the RT2 HT First Strand Kit (Qiagen; 330411). Quantitative real-time PCR was accomplished using the iCycler Thermal Cycler (Bio-Rad, 582BR). A 25-μL reaction was prepared containing 12.5 μL of RT2 SYBR Green (Qiagen; 330512), 3.5 μL of each forward and reverse primers (5 pmol/μL) noxa (PMAIP1); forward sequence: 5’ CTCAAACCTCCAAAAGCC 3’, reverse: 5’ CCTGAGCAGAAGAGTTTGGA 3’,hmox-1 forward sequence: 5’ CTCAAACCTCCAAAAGCC 3’, reverse: 5’ TCAAAAACCACCCC AACCC 3’), 4 μL of cDNA template and 1.5 μL of nuclease-free water. All PCR experiments contained three technical replicates and included a negative control consisting of H2O, instead of DNA template, and three independent experiments were performed. Fold change numbers were obtained using the comparative CT method (Schmittgen and Livak 2008 (link)). Data were normalized to a housekeeping gene (GAPDH) for equal loading amounts.
Gutierrez D.A., DeJesus R.E., Contreras L., Rodriguez-Palomares I.A., Villanueva P.J., Balderrama K.S., Monterroza L., Larragoity M., Varela-Ramirez A, & Aguilera R.J. (2019). A new pyridazinone exhibits potent cytotoxicity on human cancer cells via apoptosis and poly-ubiquitinated protein accumulation. Cell biology and toxicology, 35(6), 503-519.
+ Open protocol
+ Expand
10

Quantitative gene expression analysis

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA (2 μg) was used to prepare cDNA with 10 mM dNTPs, 200 units MMLV reverse transcriptase, and 50 μg random hexamers (Promega, Madison WI, USA). Primers used were previously published [37 (link), 45 (link)] and pimer sequences and annealing temperatures are provided in Table 1. Samples were diluted 1:10 and amplified in triplicate using a 96-well CFX Real-Time PCR (Bio-Rad, Hercules CA, USA) with 0.25X RT2 SybrGreen (Qiagen, Frederick MD, USA) compared to the geometric mean of the reference genes, 18S and GAPDH. Standard curves were used to determine efficiency using a mix of samples containing all cDNA samples diluted at 1:1, 1:4, 1:16 1:64, 1:256, and 1:1024 and gene expression quantified using the modified Muller’s method [52 (link), 53 (link)].
Heintz M.M., Eccles J.A., Olack E.M., Maner-Smith K.M., Ortlund E.A, & Baldwin W.S. (2022). Human CYP2B6 produces oxylipins from polyunsaturated fatty acids and reduces diet-induced obesity. PLOS ONE, 17(12), e0277053.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!