Primescript rt master mix

Total RNA was isolated using the TRIzol agent (Invitrogen, Carlsbad, CA, USA) and RNA samples (1 μg) were reverse transcripted to cDNA using PrimeScript RT Master Mix (538100; Toyobo, Osaka, Japan). The qPCR was performed using SYBR-Green PCR Master Mix (15153900; Roche, Indianapolis, IN, USA) on the Applied Biosystems 7900HT Real-time PCR system. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was used as an internal control for each sample, and the expression of each sample was normalized to GAPDH mRNA. Primers used were as follows: TMPRSS4 forward, 5′-CCGATGTGTTC AACTGGAAG-3′ and reverse, 5′-GAGAAAGTGAGTGG GAACTG-3′; GAPDH forward, 5′-GCACCGTCAAGGCTG AGAAC-3′ and reverse, 5′-TGGTGAAGACGCCAGTGGA-3′. After denaturation for 10 min at 95°C, the reaction was continued for 40 cycles at 94°C for 10 sec, 60 or 62°C for 20 sec and 72°C for 20 sec. The relative expression of each miRNA was calculated using the 2^−ΔΔCt method.

Total RNA extraction from the cells was carried out utilizing Trizol (Invitrogen). Subsequently, cDNA was synthesized from 1 μg of total RNA employing the PrimeScript RT Master Mix (TOYOBO, Japan). Reverse transcription quantitative PCR (RT-qPCR) was conducted using the Fast SYBR Green Master Mix (TOYOBO, Japan) on a 7500 Fast Real-Time PCR system. Quantification of gene expression was performed using the delta-delta CT method, with target gene expression levels being normalized to β-actin expression levels. The primer sequences used are provided below:
ICAM-1, ATCTGTGTCCCCCCTCAAAAGTC (forward), CCATCAGGGCAGTTTGAATAGC (reverse); IL-6, 5’-ACTCACCTCTTCAGAACGAATTG-3’ (forward), 5′-CCATCTTTGGAAGGTTCAGGTTG-3’ (reverse); Cx43, 5′-TCTGAGTGCCTGAACTTGC-3’ (forward), 5′-ACTGACAGCCACACCTTCC-3’ (reverse); β-actin, 5’-ATCACCATTGGCAATGAGCG-3’ (forward), 5’-TTGAAGGTAGTTTCGTGGAT-3’ (reverse).

TRIzol^® reagent (Thermo Fisher Scientific, Inc) was used for RNA extraction when cell confluence was 70-80%. Prime Script RT Master Mix (Toyobo Life Science) was used for mRNA reverse transcription. Reverse transcription of miRNA was performed using miRNA first-strand cDNA synthesis (tailing method) kit (Sangon Biotech, China). RT-qPCR was performed using SYBR Premix EX Taq TMII (Toyobo Life Science). RNA extraction, cDNA synthesis and qPCR were performed according to the manufacturer's protocols. PCR cycle conditions: Denaturation (95°C, 30 sec); annealing (95°C, 5 sec) and extension (60°C, 30 sec) for 40 cycles. Quantification method was ΔCt=Ct (target gene)-Ct (internal reference gene), ΔΔCt=ΔCt (experiment group)-ΔCt (control group) and final results were shown as 2^ΔΔCq (12 (link)). These experiments were repeated at least 3 times. The internal references for mRNA and miRNA extracted from cells were GAPDH and U6, respectively. However, miRNAs extracted from exosomes used miR16-5p as an internal reference. The primer sequences for RT-qPCR are given in Table SI.