Nickel chelate column

The hexahistidine-tagged E. coli FadR proteins were produced in E. coli BL21 (DE3) carrying the appropriate expression plasmids (e.g., pET28-fadRec, Table 1) by induction of bacterial cultures at an OD_{600 nm} of 0.8–1.0 with 0.3 mmol/L IPTG at 30°C for 3 h (Feng & Cronan, 2011b (link), Feng & Cronan, 2010 (link)). The cells were pelleted, washed twice with ice-cold PBS buffer (101.4 mmol/L Na₂HPO₄, 1.8 mmol/L KH₂PO₄, 137 mmol/L NaCl, 2.7 mmol/L KCl, 8% glycerol, pH7.4), dissolved in the same buffer and lysed using a French Press. The extracts were centrifuged to remove bacterial debris and the supernatants loaded onto a nickel chelate column (Qiagen). Following washing with ten column volumes of PBS buffer containing 50 mmol/L imidazole, the FadR proteins were eluted with 150 mmol/L imidazole. Appropriate eluted protein fractions were pooled and dialyzed against PBS buffer, then concentrated by ultrafiltration (30 kDa cut-off, Amicon Ultra) (Feng & Cronan, 2010 (link)). The protein purity was judged by 12% SDS-PAGE, followed by staining with Coomassie brilliant blue R250 (Sigma, St. Louis, MO).

To prepare the recombinant CRP protein in two versions (CRP_ec and CRP_she), the engineered E. coli strains carrying either pET28-crp_ec or pET28-crp_she (Table1) were induced with 0.3 mmol/L isopropyl β-d-1-thiogalactopyranoside (IPTG) at 30°C for 5 h(Feng and Cronan 2012 (link)). Following bacterial lysis by a French pressure cell, the clarified supernatants by centrifugation (30,966g, 30 min) were loaded onto a nickel chelate column (Qiagen). After removal of the contaminated protein by washing with 1×phosphate buffered saline (PBS) with 50 mmol/L imidazole, the interested CRP proteins (CRP_ec or CRP_she) were eluted using elution buffer containing 150 mmol/L imidazole. Finally, the protein was concentrated by ultrafiltration (30 kDa cut-off) and exchanged into 1× PBS (pH 7.4) containing 10% glycerol. The purity of the recombinant CRP proteins was judged by 12% sodiumdodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) (Feng and Cronan 2009b (link), 2011b (link)). To verify the identity of the acquired proteins, the de-stained (SDS-PAGE) gel slices were subjected to liquid chromatography quadrupole time-of-flight mass spectrometry using a Waters Q-Tof API-US Quad-ToF mass spectrometer linked to a Waters nanoAcquity UPLC(Feng and Cronan 2011a (link); Feng et al. 2013a (link),b (link)).

The 1-11E/vIL-10 fusion was cloned into pcDNA6 vector (Invitrogen, Paisley, UK). vIL-10 was PCR with the following primers: Forward: 5′-AAAGCGGCCG CAGGGGGAGGCGGATCCCCGCTCGGGCTTTGGGCGGGAGGGGGCTCACAATGT GACAATTTTCCC-3′ and reverse: 5′TTTTGCGGCCGCCCTGGCTTTAATTGTCAT-3′. This resulted in vIL-10 omitted from its signal peptide at the 5′ end and replaced with the MMP cleavage site (PLGLWA) flanked by Gly₄Ser₁ linker from both sides (Figure 1A). After cloning IL-10 into the NotI and SacII restriction sites, the scFv was amplified to contain the TNFR2 signal peptide (MAPAALWVALVFELQLWATGHT): forward: 5′-ATATATAAGCTT ATGGCGCCCGCCGCCCTCTGGGTCGCGCTGGTCTTCGAACTGCAGCTGTGGGCCACCGGGCACACATCTAGAATGGCCGAGGTGCAGCTG-3′, and reverse: 5′-ATATATGC GGCCGCCCGTTTGATTTCCACCTT-3′ and cloned into the HindIII and NotI. Similarly, hen egg lysozyme-specific scFv, C7, was cloned as fusion to vIL-10 (C7/vIL10) as nonrelevant scFv for negative control.
We performed transient transfections by using adherent HEK-293 cells using FuGENE 6 and according to manufacturer’s instructions (Promega UK, Southampton, UK). Culture medium was harvested after 3 days, and fusion protein was purified by using a nickel chelate column (QIAGEN, Crawley, UK) and following the manufacturer’s instructions.