Pcdna6 tr vector

The cloning of the pBABE‐CD3 and pcDNA4‐Tet‐hAID was described previously [14]. The pCL‐Ampho vector was a kind gift from Prof. Haim Cohen (Bar Ilan University, Ramat Gan, Israel). The pCL‐Eco and codon‐optimized pMSGV1‐Pmel‐1 TCR vector (codon optimized Pmel‐1α and β chains separated by a T2A segment) vector were a kind gift from Dr. Nick Restifo (NIH, Bethesda, MD, USA), as previously described [42]. The codon‐optimized MP71‐hT27 TCR and MP71‐T1367 TCR vectors containing mouse constant regions were a kind gift from Prof. Thomas Blankenstein (MDC, Berlin, Germany), as previously described [10]. The mutant MP71‐hT27 TCR vectors and pcDNA4‐Tet‐hAID mut 7.3 vector, as previously described [25], were generated using site‐directed mutagenesis (SDM) with the Phusion SDM Kit (Thermo‐Fischer Scientific, Waltham, MA, USA) according to the manufacturer's protocol. The pCDNA6‐TR vector, containing the TetR (or TR), was purchased commercially (Invitrogen, Carlsbad, CA, USA). The pMSGV1‐TetR vector was generated using restriction‐free cloning, as previously described [43], with the Phusion HSII HF polymerase (Thermo‐Fischer Scientific) according to the manufacturer's protocol. Sequencing primers: MP71 For: ATTTGTCTGAAAATTAGCTCGA, MP71 Rev: AGAGCAACTACAGCTACTGC, hT27 internal For: CATTTAAATGTATACCCAAATCAA, pMSGV1 For: CCTCAAAGTAGACGGCATCG (Sigma‐Aldrich, Rehovot, Israel).