Total RNA was extracted from cholesterol treated and untreated BRIN-BD11 cells using TRIzol reagent (Life Technologies) and 1 μg of total RNA was used to synthesize cDNA using Superscript III First-Strand cDNA synthesis kit. Quantitative real-time PCR was performed in the Step One -Plus Real -Time PCR system using kapa sybr fast universal master mix (Kapa Biosystems). The relative abundance of the mRNAs was measured using 2−ΔΔCT 48 with GAPDH mRNA as invariant reference.
Steponeplus real time pcr system
Manufactured by Roche
Sourced in Switzerland, United States, China, Germany
The StepOnePlus Real-Time PCR System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of detecting and quantifying specific nucleic acid sequences in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (15 mentions)
Sybr green master mix, by Roche (8 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Cdna reverse transcription kit, by Takara Bio (3 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Iscript reverse transcription supermix, by Vazyme (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Takara Bio (2 mentions)
Faststart universal sybr green master, by Roche (2 mentions)
Direct zol rna miniprep kit, by Zymo Research (2 mentions)
Faststart universal sybr green pcr master mix, by Roche (2 mentions)
Verso cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Sybr rt pcr kit, by Roche (2 mentions)
Sybr green, by Roche (2 mentions)
Kapa sybr fast universal master mix, by Roche (1 mentions)
Rnase free dnase set, by Tiangen Biotech (1 mentions)
Kapa sybr fast qpcr kit master mix 2x universal, by Roche (1 mentions)
Rneasy mini kit, by Tiangen Biotech (1 mentions)
41 protocols using steponeplus real time pcr system
1
Cholesterol Regulation of Gene Expression
2
Quantitative Gene Expression Analysis in Drosophila Heads
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Male flies for each genotype were collected at ZT16 (Zeitgeber Time, ZT0 indicates lights-on and ZT12 lights-off). Heads were isolated and subjected to total RNA isolation using TriReagent (MRC Inc., Irvine, CA, United States) according to the manufacturer’s protocol. Brains were extracted from fixed heads at 100% ethanol for 2 h. The RNA quality and quantity were assessed using Nanodrop 2000 (Thermo Fisher Scientific, MA, United States). cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Vilnus, Lithuania) with random primers according to the provider’s instruction. Gene expression was examined using StepOnePlus Real-Time PCR System and SYBR Green Master Mix (KAPA Biosystems, Cape Town, South Africa) in the presence of specific primer sequences (the specificity was controlled with Primer-BLAST and gel electrophoresis) for the target genes which are listed in Table 1 . This entire procedure was followed in experiments analysing gene expression levels, which were repeated at least three times per genotype with approximately 20 fly heads for each replicate.
3
Quantitative Analysis of Xenopus Embryonic Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RT PCR and Chromatin immunoprecipitation assays samples were subjected to qPCR analysis using Biosystems StepOnePlus Real-Time PCR System with Kapa Syber Fast qPCR Master mix. All values were normalized to ornithine decarboxylase (ODC), a house keeping gene of Xenopus embryos which is present all around the embryonic developmental. Graphs were made using threshold cycle (Ct) values, ΔCT, ΔΔCT and relative fold change expression method.
4
Temporal Expression Dynamics of Clu in Mouse Inner Ear
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the inner ear of C57BL/6 wild-type mice using the RNeasy Mini kit (Tiangen, China). The RNase-free DNase set (Tiangen) was used to remove contaminated DNA. RNA concentration and purity were estimated via spectrophotometry by measuring the absorbance at 260 nm and 260/280 nm ratio, respectively. cDNA was synthesized from RNA using the High Capacity cDNA Reverse Transcription Kit (KAPA BIOSYSTEMS, USA) and oligo-dT primers. Subsequently, qRT-PCR was performed to analyze Clu expression at postnatal days 3 (P3), 12 (P12), 30 (1 m), and 180 (6 m). Four mice per group/age were used. qRT-PCR primers were designed based on published reference sequences in the National Center for Biotechnology Information database (NM_013492.3). qRT-PCR was performed using the KAPA SYBR®FAST qPCR Kit Master Mix (2X) Universal (KAPA BIOSYSTEMS) on a StepOnePlus Real-Time PCR System. Each sample was run in triplicate along with the housekeeping gene, GAPDH. Relative quantities of the transcripts were determined using 2−△△CT method using GAPDH as a reference.
5
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA that was exacted with TRIzol (Invitrogen) was used for cDNA synthesis with the Thermo Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qPCR was performed using a StepOne Plus real-time PCR system (KAPA). The specific primers used for qPCR are listed in table S1.
6
Quantitative Analysis of CBX2 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We generated the p.Cys132Arg and p.Cys154fs variant CBX2.2s by site directed mutagenesis of wild‐type cDNA (Origene), according to the manufacture's manual (Quickchange II Site‐Directed Mutagenesis Kit; Agilent).
The influence of WT and CBX2.2 variants on the expression of selected candidate genes was studied by means of quantitative real‐time PCR, performed with ABI StepOnePlus Real‐Time PCR system, PCR products were quantified fluorometrically using the KAPA SYBR FAST master mix (KAPA Biosystems, Wilmington, Massachusetts, USA). The reference mRNA from cyclophilin was used for data normalization. Primers sequence and qRT‐PCR conditions for CBX2 isoforms and putative targets are available upon request. All samples were run in triplicates and finally the normalized relative expression values (2 − Δ Δ C t
The influence of WT and CBX2.2 variants on the expression of selected candidate genes was studied by means of quantitative real‐time PCR, performed with ABI StepOnePlus Real‐Time PCR system, PCR products were quantified fluorometrically using the KAPA SYBR FAST master mix (KAPA Biosystems, Wilmington, Massachusetts, USA). The reference mRNA from cyclophilin was used for data normalization. Primers sequence and qRT‐PCR conditions for CBX2 isoforms and putative targets are available upon request. All samples were run in triplicates and finally the normalized relative expression values (
7
Quantitative RT-PCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qPCR reactions were performed by using an Applied Biosystems StepOnePlus Real-Time PCR System with KAPA SYBER FAST qPCR Master Mix. All the real-time values were averaged and compared using the threshold cycle (CT) method, in which the amount of target RNA (2 − ΔΔCT) was normalized against the endogenous expression of ODC (ornithine decarboxylase) (ΔCT). The qPCR reactions were performed when RT-PCR reaction results need to be quantified (Fig. s1 ). The confirmed data as elsewhere published data (vent1.1)57 (link) was not repeated. All qPCR reactions were repeated three time using independent samples to present data with standard deviations and statistical significance.
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation was extracted with a RNAprep pure Plant Kit (Tiangen, Beijing, China). Semi-quantitative RT-PCR and qRT-PCR were performed as described previously [25 (link)]. Double-stranded cDNA was synthesized with cDNA Synthesis Kit (Takara, Dalian, China). qRT-PCR was performed on a StepOnePlus™ Real-Time PCR System with SYBR green master mix (Roche, Mannheim, Germany). ∆∆CT method was employed to assess transcriptional level of the target genes, and actin-encoding gene (ACT1) was used as the reference gene.
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Realtime quantitative PCR (qRT-PCR) was carried out using an Applied Biosystems StepOnePlus Real-Time PCR System with FastStar Universal SYBR Green Master (Rox) (Roche) [17 (link)]. The gene primers used in qRT-PCR reactions are listed in S1 Table . For each gene, all PCR reactions were carried out in triplicate within a single plate, with rpoA used as the reference gene. Quantification of relative gene expression was analyzed using the 2-ΔΔCt method [22 (link)].
10
Quantifying Cacao Transcription Factor LEC2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples were extracted and reverse-transcribed into cDNA as described above. The primers to detect TcLEC2 transcripts were designed based on the coding sequence of TcLEC2 (Tc06g015590 [32 (link)]) (TcLEC2-Realtime-5′: TGACCAGCTCTGGTGCTGACAATA; TcLEC2-Realtime-3′: TGATGTTGGGTCCCTTGGGAGAAT). qRT-PCR was performed in a 10 μl mixture containing 4 μl diluted-cDNA (1:50), 5 μl SYBR Green PCR Master Mix (Takara), 0.2 μl Rox, and 0.4 μl each 5 μM primers. Each reaction was performed in duplicates in Roche Applied Biosystem StepOne Plus Realtime PCR System under the following program: 15 min at 94°C, 40 cycle of 15 s at 94°C, 20s at 60°C, and 40 s at 72°C. The specificity of the primer pair was examined by PCR visualized on a 2% agarose Gel and dissociation curve. An acyl carrier protein (Tc01g039970, TcACP1 [32 (link)] TcACP1-5′: GGAAAGCAAGGGTGTCTCGTTGAA and TcACP1-3′: GCGAGTTGAAATCTGCTGTTGTTTGG), and a tubulin gene in cacao (Tc06g000360, TcTUB1 [32 (link)] TcTUB1-5′: GGAGGAGTCTCTATAAGCTTGCAGTTGG and TcTUB1-3′: ACATAAGCATAGCCAGCTAGAGCCAG) were used as the reference genes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!