Takara sybr premix ex taqtm 2 tli rnaseh plus

The APDBD-treated spots were taken up in distilled water (Otsuka Pharmaceutical Co. Ltd.) and boiled for 15 min to extract the genomic DNA. The resultant samples were subjected to real-time PCR analysis to quantify intact genomic DNA using Takara SYBR Premix Ex TaqTM II (Tli RNaseH Plus, Takara Bio Inc.) and specific primers for Penicillium 28S rDNA D1/D2 region (target size: 107 bp), including Forward primer (5′-GGG ACG TCA TAG AGG GTG AG-3′) and Reverse primer (5′-CCA CCC ATT TAG AGC TGC AT-3′), as well as for Aspergillus 28S rDNA D1/D2 region (target size:159 bp), including Forward primer (5′-CGG AGT CCG CAT TGT AAT TT-3′) and Reverse primer (5′-AGC TGC ATT CCC AAA CAA CT-3′). Amplification conditions were as follows. After heating at 95˚C for 30 s, the fluorescence intensity of the samples was measured during the PCR comprising 40 cycles of 95˚C for 5 s and 60˚C for 30 s using a Thermal Cycler Dice Real-time System (Takara Bio Inc.). The amplified DNA was verified by dissociation curve analysis. The PCR product was sized by agarose gel electrophoresis.

To normalize expression data, β-actin was used as an internal control. The specific primers used to quantify Bmakr and B. microti actin (Cornillot et al., 2012 (link)) (GenBank Accession Number, XM_012793635) were as follows: Forward: CTCAAGGGCTGTGAAAGAGTAC and Reverse: GAAGCTGGTATAAATCGTTGGCC for Bmakr, and Forward: GCTCTCATGATTGGAATGGACG and Reverse: AACCGAATGTTCTTCAGGAT for β-actin. The qRT-PCR was performed with a TAKARA SYBR^® Premix Ex Taq TM II (Tli RNaseH Plus) (TAKARA, Dalian, China.) using a CFX96 Touch^TM Real-Time PCR System (Bio-Rad). Dissociation curve analyses and gel electrophoresis of target gene amplicons were performed for each sample following the qRT-PCR step to ensure primer fidelity. All qRT-PCR amplifications were performed in triplicate and repeated twice, with the mean values considered for comparison. To determine the relative transcriptional level of Bmakr at different infection periods, the total RNA extracted from iRBC at different developmental stages were subjected to qRT-PCR analysis. Five groups of mice were injection with 10⁸ iRBCs, and blood was collected from days 2 to 14 after injection.