Five single guide RNAs (sgRNAs) were designed to target Acipenser ruthenus dnd1 (Ardnd1) gene. Target sites were, sgSRNA1: GGGGGGAATGCAGTCCAACC; sgRNA2: GGGGGAATGCAGTCCAACC; sgRNA3: TTCAATCATTTTCTTTCTTA; sgRNA4: TGGTTTAAAACCGTAAAGAT and sgRNA5: ATTTTCTGAGTCCATGTTTC. Oligos for sgRNAs were ordered from Macrogen Company (Macrogen Inc., Amsterdam, the Netherlands) and were annealed according to references [41 (link),42 (link)] (Figure S1 ). In vitro transcription (IVT) using HiScribeTM T7 High Yield RNA synthesis kit (NEB) was used to generate sgRNAs, according to manufacturers’ instructions. Synthesized sgRNAs were treated with DNAse to remove any remaining DNA traces and mySPEC spectrophotometer (VWR® mySPEC spectrophotometer) was used for sgRNAs quantification. All sgRNAs were diluted and aliquoted. Cas9 protein was purchased from PNA Bio and was re-suspended as per manufacturers’ instructions, aliquoted and stored at −80 °C.
Myspec spectrophotometer
Manufactured by Avantor
Sourced in Germany
The MySPEC spectrophotometer is a laboratory instrument designed for the measurement and analysis of light absorption or transmission properties of various samples. It is capable of providing precise and reliable data on the optical characteristics of substances across a range of wavelengths.
Automatically generated - may contain errors
Lab products found in correlation
Hiscribe t7 high yield rna synthesis kit, by New England Biolabs (1 mentions)
Cas9 protein, by PNA Bio (1 mentions)
Dneasy powerwater kit, by Qiagen (1 mentions)
Fastdna spin kit for soil, by MP Biomedicals (1 mentions)
Qubit dsdna hs br assay kit, by Thermo Fisher Scientific (1 mentions)
Masterpure complete dna and rna purification kit, by Illumina (1 mentions)
Mmessage mmachine t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
5 protocols using myspec spectrophotometer
1
CRISPR sgRNAs for Acipenser ruthenus dnd1
2
DNA Extraction from Wastewater Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PES-membrane filters resulting from the WW filtrations (residues and filters) underwent DNA extraction. Genomic DNA was extracted from each replicate (3 replicates per WW sample) of each treated and untreated WW sample using a DNeasy PowerWater kit (Qiagen GmbH, Hilden, Germany). The yielded DNA concentration and integrity were measured on a mySPEC Spectrophotometer (VWR, Radnor, PA, USA). The final concentration of purified DNA ranged from 20 to 45 ng·μL−1 with both 260/280 and 260/230 ratios between 1.8 and 2.0.
3
Iron-Driven Anaerobic Enrichment Metagenomics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from triplicate enrichments grown in 50 ml of media with 5 g of Fe0 as the sole electron donor. Extractions were only carried out on the entire corrosive community (untreated with inhibitors) at the 1-month mark of the 4th transfer (for shotgun metagenome sequencing) and 11th transfer (for amplicon sequencing), when both acetogens and methanogens are sufficiently active according to physiology data.
Before metagenome sequencing, genomic DNA was isolated from the pellets of triplicate enrichments (fourth transfer) using commercially available kits, as previously described (Palacios et al., 2019 (link)).
Before amplicon sequencing, genomic DNA was isolated from the cell filtrates of triplicate enrichments (11th transfer) using a FastDNA Spin kit for Soil (MP Biomedicals, United States) with the following modifications: to the Lysing Matrix E tube, we added 500 μl of sample, 480 μl of sodium phosphate buffer, and 120 μl of MT buffer. Bead beating was performed at 6 m/s for 4 × 40 s (Albertsen et al., 2015 (link)).
The integrity of genomic DNA was verified on an agarose gel and quantified on a mySPEC spectrophotometer (VWR®/Germany) or Qubit dsDNA HS/BR Assay kit (Thermo Fisher Scientific, United States).
Before metagenome sequencing, genomic DNA was isolated from the pellets of triplicate enrichments (fourth transfer) using commercially available kits, as previously described (Palacios et al., 2019 (link)).
Before amplicon sequencing, genomic DNA was isolated from the cell filtrates of triplicate enrichments (11th transfer) using a FastDNA Spin kit for Soil (MP Biomedicals, United States) with the following modifications: to the Lysing Matrix E tube, we added 500 μl of sample, 480 μl of sodium phosphate buffer, and 120 μl of MT buffer. Bead beating was performed at 6 m/s for 4 × 40 s (Albertsen et al., 2015 (link)).
The integrity of genomic DNA was verified on an agarose gel and quantified on a mySPEC spectrophotometer (VWR®/Germany) or Qubit dsDNA HS/BR Assay kit (Thermo Fisher Scientific, United States).
4
High-Yield DNA Purification from Iron-Rich Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA purification was performed using a combination of two commercially available kits; the MasterPure™ Complete DNA and RNA Purification Kit (Epicenter, Madison, Wi, USA), and the Fast Prep spin MPTM kit for soil (Mobio/Qiagen, Hildesheim, Germany). For DNA extraction, we pelleted 10 mL cells, either by harvesting an entire culture grown on Fe0 or by removing 10 mL from a larger volume after vigorous shaking the Fe0-cultures in order to detach cells from the Fe0-surface. We used an Epicenter kit to initiate the DNA extraction with the following modifications to the manufacturer’s protocol: a three-fold higher concentration of proteinase K was added to ensure cell lysis, and a prolonged incubation time at 65 °C was performed until the color of the samples changed from black to brown (the brown pellet gave higher DNA extraction efficiencies). After DNA extraction, we used the Fast Prep spin MPTM kit for soil to carry out RNase treatment and protein precipitation. An advantage of this kit is that it allowed removal of the high iron content, while simultaneously purifying DNA on a binding matrix. Quality and quantity of genomic DNA were determined by electrophoresis on a 1% agarose gel and by UV spectrophotometry on a mySPEC spectrophotometer (VWR®, Germany).
5
Rat Syn III mRNA Microinjection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A recombinant plasmid containing the coding region of rat Syn III mRNA (p3x-FLAG-CMV-14-rat Syn III, a kind gift of Dr. Franco Onofri, University of Genova, Italy) was digested with Xba I/Hind III restriction enzymes and subcloned in pCS2+ plasmid (a kind gift of Prof. Franco Cotelli, University of Milan). The resulting linearized plasmid was transcribed with T7 RNA polymerase using the mMESSAGE mMACHINE T7 Transcription Kit (AM1344, ThermoFisher Scientific, Waltham, MA, USA) according to manufacturer’s protocol. The product was quantified by mySPEC spectrophotometer (VWR International, Milan, Italy) and used for microinjections. A dose-response curve was performed to establish the proper amount of mRNA (100 pg/embryo) to be injected to avoid the appearance of aberrant phenotypes. 100 pg of rat Syn III mRNA was injected alone or co-injected with Syn III-MO at 1-2 cell stage embryos.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!