Rt2 profiler web based pcr array data analysis software

RNA was isolated from adult and neonatal mouse brains using the Qiagen RNeasy Midi Kit (75124, Qiagen, Valencia, CA). The extracted RNA was assessed by UV spectrophotometry to measure concentration and purity on a Nanodrop (ND-1000, Thermo Scientific). Cytokine and chemokine gene expression was assessed using the mouse cytokine and chemokine RT2 Profiler PCR Arrays (PAMM-150Z, Qiagen) by the manufacturer. The expression of 84 inflammatory genes and 5 housekeeping genes were assessed. Data analysis was done using the SABiosciences RT2 Profiler Web-Based PCR Array Data Analysis software, which automatically performs the Delta Ct (ΔΔCt) fold-change calculations from the uploaded raw threshold cycle data. The fold-change in infected brains as compared to uninfected controls was calculated after normalizing to the housekeeping genes.

Total RNA was extracted from CB-MSC using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA). Complementary DNA was synthesized using the SuperScript III first-strand synthesis system for RT-PCR (Invitrogen Life Technologies, Carlsbad, CA). mRNA expression of human IDO and GAPDH was examined by real-time PCR using SYBR green gene expression assays and the following primers: IDO1 F: 5′ GAAGTGGGCTTTGCTCTGC 3′ and R: 5′ TGGCAAGA CCTTACGGACATCTC 3′; GAPDH F: 5′ ACCACAGTCCATGCCATCAC 3′ and R: 5′ TCCACCACCCTGTTGCTGTA 3′.
Human RT² Profiler PCR array (QIAGEN, Hilden, Germany) analyzed the expression of 252 genes involved in JAK-STAT, PI3K, and mTOR pathways (QIAGEN core services, http://www.sabiosciences.com). Data were analyzed with the SABiosciences RT² Profiler Web-Based PCR Array Data Analysis software.