Lightcycle 96 system

Quantitative real-time PCR (Q-RT-PCR) assays were performed using a set of published primers and probes [15 (link)], targeting regions of the glycoprotein gene (F: 5’-TGGGCTGAAAAYTGCTACAATC-3’; R: 5’-CTTTGTGMACATASCGGCAC-3’; Probe: FAM-5′-CTACCAGCAGCGCCAGACGG-3′-TAMRA). RNA was amplified using the One Step PrimeScript RT-PCR Kit (TaKaRa, Japan), and 40-cycle Q-RT-PCR assays were run on the LightCycle 96 System (Roche, Switzerland). Melt curve analysis was performed to confirm the identity of the amplification products. The specimens were considered positive if there was an apparent logarithmic phase in the amplification curve, with melting point confirmed amplification products and the Ct value≤36 (Ct value<26, intense positive; 26≤Ct value≤ 36, weak positive). In contrast, the specimens were considered negative if there was no apparent logarithmic phase, with the Ct value undetermined, and they were considered suspect when 36

Total RNA was isolated using an RNA isolation kit (Tiangen Biotechnology, Beijing, China) and reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan) following the manufacturer’s instructions. Real-time PCR was performed using Fast Start Universal SYBR Green Master Mix (Roche, Germany) and a Light Cycle 96 system for 10 min at 95 °C, 15 s at 95 °C, and 1 min at 60 °C. The expression levels of target genes were normalized to GAPDH expression. The results were analyzed using the 2^–ΔΔCT method. The primer sequences are summarized in Table 1.Table 1

Primer sequences used in qRT-PCR experiments

mRNA	Forward primer	Reverse primer
XBP1	CTGGAACAGCAAGTCGTGGA	GCTGCAGATGCACGTAGTCT
ATF4	AGTGGACCTCAAGGAGTTCG	CAAGCTGAACGACTCATCCG
ATF6	GCAAACCAGAGGAGGCATCT	CCTGAGCGACTCTGTTGTGT
ACAN	TTGCCTTTGTGGACACCAGT	GAGCCAAGGACGTAAACCCA
SOX9	GACGCACATCTCGCCCAAC	TCTCGCTTCAGGTCAGCCTT
COL2A1	ACTGGTGGAGCAGCAAGAGC	GACGTTGGCAGTGTTGGGAG
COL1A1	GCCACCTCAAGAGAAGGCTG	CTCGGGGCTCTTGATGTTCT
GAPDH	GTCATCATCTCAGCCCCCTC	GGATGCGTTGCTGACAATCT

Total RNA of leaves were extracted as mentioned previously. Reverse transcription was performed with 2 μg of RNA through TransScript^® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China) according to the manufacturer’s instruction. RT-qPCR was performed on the LightCycle 96 system (Roche, Switzerland) using SYBR Green Master Mixture (TransGen, Beijing, China) according to the manufacturer’s instruction. Soybean TUA5, Arabidopsis AtActin2, or rice OsUbi5 was used as an internal control for normalization. PCR cycling conditions were set up as in the following program: 94 °C for 30 s, followed by 40 cycles of 94 °C for 5 s and 60 °C for 30 s with fluorescence signal collection. Melting and cooling steps were set as default parameters. Relative gene expression levels were calculated using the 2^−ΔΔCt method. Three independent biological replicates were obtained and subjected to real-time PCR in triplicate. Raw data were standardized as described previously59 (link). All primers for expression analysis are listed in Supplementary Table S3.

In total, twenty-seven differentially expressed flavonoid, ascorbic acid, glutathione, and ASA–GSH metabolism-related unigenes were selected for qRT–PCR analysis. The reverse transcription kit (Vazyme, Nanjing, China) reverse transcribes 1 μg of total RNA into cDNA for qPCR. The qRT–PCR reactions were carried out using a 20 μl reaction volume containing Chamq universal SYBR qPCR master mix (Vazyme, Nanjing, China), primer, cDNA template, and ddH₂O and were performed on a LightCycle 96 system (Roche, Switzerland). All the primers of unigenes were designed online by the Integrated DNA Technologies website (Supplementary Table 1). The relative expression levels of unigenes were calculated by the 2^–ΔΔCT method using the 18s gene of P. ternata as a reference gene (Xue et al., 2019 (link)).

WB analysis (20 μg of liver protein) was performed using anti-AMPKα (#2532, Cell Signaling Technology, Danvers, MA, USA), P 53 (A0263, ABclonal, Wuhan, China), caspase 3 (13847, Abcam, Cambridge, MA, USA) and anti-β-tubulin (10094-1-AP, Proteintech, Rosemont, IL, USA) antibodies. These antibodies have all been shown to successfully cross-react with M. amblycephala proteins. The signals of WB were quantitatively assayed by ImageJ 1.44 image analysis software.
Total RNA was extracted from the liver using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and its RNA concentration was detected by a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Then, cDNA was synthesized using PrimeScript Ist strand cDNA synthesis kit (Takara, Tokyo, Japan). Finally, the expression levels of target genes were detected by real-time PCR with specific primers (Table 2) under the SYBGREEN-based Light Cycle 96 system (Roche, LC96). EF1α (elongation factor 1 alpha) gene was used as an endogenous control because of the non-significant changes in the Ct value between the treatments. The expression levels of target genes were normalized by the expression of EF1α, and the relative expression levels were calculated by 2^−ΔΔCt method [28 (link)].