Individual sperm (n = 36) and blastocysts (n = 24) underwent targeted bisulfite pyrosequencing using the PyroMark Q24 Advanced system (Qiagen). Genomic DNA was isolated using the Norgen RNA/DNA/Protein Kit (Norgen) for sperm and the QIAamp DNA Micro Kit (Qiagen) for blastocysts. Bisulfite conversion was performed using the EZ DNA Methylation‐Direct Kit (Zymo Research), followed by nested PCR amplification with the use of AmpliTaq Gold (Applied Biosystems) and a universal reverse biotinylated primer in the second round. Primers for methylation analysis (CpG) were designed with the use of PyroMark Assay Design Software v.2.0.1.15 (Qiagen) and overlapped ≥ 2 significant CpGs from the originally identified DMR. Pyrosequencing reactions were prepared using the PyroMark Q24 Advanced CpG Kit (Qiagen), and the DNA methylation level was calculated as a ratio of the C to T peaks at a given CpG site using PyroMark Q24 Advanced Software v.3.0.0. (Qiagen). Student's t test and Mann–Whitney U test were used for methylation differences between young and APA cohorts, where p ≤ .05 was considered to be statistically significant. Simple linear regression was used to calculate the association between APA and methylation as age increased. Models with p ≤ .05 were considered significant. Pyrosequencing primers designed in‐house are outlined in Table S9 .
Pyromark assay design software v2
Manufactured by Qiagen
Sourced in Germany, Australia
The PyroMark Assay Design Software v2.0 is a bioinformatics tool used for the design of pyrosequencing assays. The software assists in the selection of target DNA sequences, primer design, and the optimization of pyrosequencing parameters to enable efficient and accurate genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Pyromark q24 pyrosequencer, by Qiagen (3 mentions)
Ez dna methylation direct kit, by Zymo Research (2 mentions)
Pyromark q24 advanced system, by Qiagen (2 mentions)
Pyromark q24 advanced cpg kit, by Qiagen (2 mentions)
Pyromark q24 advanced software v 3, by Qiagen (2 mentions)
Pyromark md instrument, by Qiagen (2 mentions)
Pyro q cpg software, by Qiagen (2 mentions)
Amplitaq gold, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna micro kit, by Qiagen (1 mentions)
Gotaq dna polymerase, by Promega (1 mentions)
Streptavidin sepharose high performance bead, by GE Healthcare (1 mentions)
Pyromark binding buffer, by Qiagen (1 mentions)
Pyromark q24 vacuum workstation, by Qiagen (1 mentions)
Pyromark q24, by Biotage (1 mentions)
Pyromark q24 platform, by Qiagen (1 mentions)
Quick gdna blood kit, by Zymo Research (1 mentions)
Ez dna methylation gold kit, by Zymo Research (1 mentions)
Pyromark q24, by Qiagen (1 mentions)
Epitech bisulfite kit, by Qiagen (1 mentions)
Pyromark pcr kit, by Qiagen (1 mentions)
16 protocols using pyromark assay design software v2
1
Targeted Bisulfite Pyrosequencing of Sperm and Blastocysts
2
KCNQ1OT1 Imprinting Control Region Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Paired ICM and TE blastocyst samples (n = 24) underwent targeted bisulfite pyrosequencing for the KCNQ1OT1 imprinting control region (ICR) using the PyroMark Q24 Advanced system (Qiagen). Bisulfite conversion was performed using the EZ DNA Methylation-Direct Kit (Zymo Research), followed by nested PCR amplification using the Platinum II Hot-Start PCR Master Mix (Invitrogen); Pyrosequencing primers were designed in-house with the use of PyroMark Assay Design Software v.2.0.1.15 (Qiagen). Forward primer: GAGTTTATGGTAATGTTTGGTATTTAGAAG, Reverse primer: CGCCAGGGTTTTCCCAGTCACGACCCAAACCACCCACCTAACAAA, universal reverse biotinylated primer in the second round: 5’Biotin-CGCCAGGGTTTTCCCAGTCACGAC, and Sequencing primer: GATGGGAGGTGGGTA. Pyrosequencing reactions were prepared using the PyroMark Q24 Advanced CpG Kit (Qiagen), and the DNA methylation level was calculated as a ratio of the C to T peaks at a given CpG site using PyroMark Q24 Advanced Software v.3.0.0. (Qiagen). Student’s t test was used for methylation differences between young and APA cohorts of ICM or TE, where p ≤ 0.05 was considered to be statistically significant.
3
Quantitative Pyrosequencing Assays for Genomic Loci
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative pyrosequencing assays were designed using PyroMark Assay Design Software v2.0.1.15 (Qiagen, Valencia, CA) and performed on a PyroMark Q24 Pyrosequencer (Qiagen, Valencia, CA). Twenty-four assays were developed (Table 1 ), consisting of forward and reverse pairs of outer and inner primers and a sequencing primer (Table 2 ). Six of the assays (1Ka1–1Ka6) were for Ka16127, six were for La3279 (1La791–1La796), four were for La3304 (1La041–1La044) and two were for Og0222 (1Og1 and 1Og2) (Tables 1 , 2 ). Two assays (2KaLa2 and 2La9K2) were designed for simultaneous quantification of Ka16127+La3304 and La3279 + Ka16127, respectively, while the remaining six assays (3La94K1–3La94K6) were for simultaneous quantification of Ka16127 + La3279 + La3304. Template DNA preparation for pyrosequencing analysis was done following procedures described by Das et al. (2008 (link)).
4
Quantifying mtDNA Heteroplasmy via Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Heteroplasmy was measured by quantitative pyrosequencing. Pyromark Assay Design Software v.2.0 (Qiagen) was used to design primers for template generation, one of which contains a biotinylated tag (*BIO), and the pyrosequencing reaction (Seq). For m.3243A>G: F-*BIO-TAAGGCCTACTTCACAAAGCG, R-GCGATTAGAATGGGTACAATGAG, Seq-ATGCGATTACCGGGC; for m.8344A>G: F-*BIO-CATGCCCATCGTCCTAGAAT, R-TTTTTATGGGCTTTGGTGAGG, Seq-TAAGTTAAAGATTAAGAGA; and for m.8993T>G F-AGGCACACCTACACCCCTTA, R-*TGTGAAAACGTAGGCTTGGAT, Seq-CATTCAACCAATAGCCC. Product templates were generated with a GoTaq® DNA Polymerase (Promega) reaction according to manufacturer's protocol. Pyrosequencing was performed using the Pyromark Q24 platform according to the manufacturer's protocol, using the designed pyrosequencing primers for each mutation. Pyromark Q24 software was used to quantify the heteroplasmy levels of each mutation through comparison of the relevant peak heights of both wild-type and mutant mtDNA. The accuracy of the pyrosequencing assay was determined by generating wild-type and mutant clones, which when mixed at the correct proportions mimicked a range of heteroplasmy levels between 0 and 100% for each mutation. Each mixed sample was assessed for mutation load using pyrosequencing and used to generate a standard curve (Supplementary Material, Fig. S1 ).
5
Quantification of Mutant and Wild-Type mtDNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative levels of the mutant and WT mtDNAs were quantified using a PyroMark Q24 pyrosequencer (Qiagen) (15 (link)). Briefly, this assay was developed using PyroMark assay design software v2.0 (Qiagen). A PCR reaction was performed to amplify a 178–base pair fragment containing the C5024T mutation site using a biotinylated forward primer and a nonbiotinylated reverse primer. After adding a PyroMark binding buffer (Qiagen) and 1 μl Streptavidin Sepharose TM high-performance beads (GE Healthcare), PCR products were purified and denaturated using a Pyromark Q24 vacuum workstation (Qiagen). Sequencing was carried out with PyroMark Gold Q24 Reagents according to manufacturer’s directions, using specific gene-sequencing primers 5′Biotin TTCCACCCTAGCTATCATAAGC (forward) and GTAGGTTTAATTCCTGCCAATCT (reverse) and the sequencing primer TGTAGGATGAAGTCTTACA.
6
Allelic Quantification of NIPBL Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Allelic quantification of the mosaic NIPBL c.1435C>T mutation in individual II:1 (Family 3061) was carried out by pyrosequencing.32 (link) Oligonucleotide primers were designed with PyroMark Assay Design Software V.20 (Qiagen) and are available upon request. Pyrosequencing was carried out on a PyroMark Q24 Vacuum Prep Workstation (Biotage). The allele quantification (AQ) mode of PyroMark Q24 software (Biotage) was used for peak quantification.
7
Quantitative Pyrosequencing of mtDNA Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mtDNA mutation load for specific alleles was assessed using quantitative
pyrosequencing. The Pyromark Assay Design Software v2.0 (Qiagen, Crawley, West
Sussex, UK) was used to design locus-specific PCR and pyrosequencing primers
(Supplementary Table S2 online) for each variant, and pyrosequencing was
performed on the Pyromark Q24 platform according to the manufacturer's
protocol. Quantification of the heteroplasmy level of each variant was achieved
using Pyromark Q24 software to directly compare the relevant peak heights of the
wild-type and the mutant nucleotides at the relevant position, as described
previously.27 (link)
pyrosequencing. The Pyromark Assay Design Software v2.0 (Qiagen, Crawley, West
Sussex, UK) was used to design locus-specific PCR and pyrosequencing primers
(
performed on the Pyromark Q24 platform according to the manufacturer's
protocol. Quantification of the heteroplasmy level of each variant was achieved
using Pyromark Q24 software to directly compare the relevant peak heights of the
wild-type and the mutant nucleotides at the relevant position, as described
previously.27 (link)
8
Quantifying mitochondrial m.3243A>G Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The assessment of m.3243A>G mutation load was performed by quantitative pyrosequencing. Pyromark Assay Design Software v.2.0 (Qiagen, Hamburg, Germany) was used to design locus-specific PCR and pyrosequencing primers. A 211 bp PCR product spanning the m.3243 nucleotide was amplified using a biotinylated forward primer (nt 3143–3163) and a reverse primer (nt 3353–3331). Pyrosequencing was carried out on the Pyromark Q24 platform according to the manufacturer's instructions, using a mutation-specific reverse primer (nt 3258–3244). Levels of m.3243A>G heteroplasmy were determined using Pyromark Q24 software, which directly compares the relevant peak heights of both WT and mutant mtDNA at this site.
9
Quantifying SHP-1 Promoter Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methylation of the bisulfite treated DNA was quantified using pyrosequencing of the SHP-1 promoter 2 region. The CpGs islands were selected in the promotor region, flanking the 5′-untranslated region (5′UTR). We studied 4 CpG sites in the selected CpG islands. Using Py-roMark Assay Design Software v2.0 from Qiagen (Hilden, Germany), the primers for pyrosequencing analysis and PCR amplification were designed. The primers were synthesized by Qiagen PyroMark-Custom Assay (Hilden, Germany) for pyrosequencing analysis and PCR amplification. To allow for biotinylated PCR products, biotinylated-reverse primers were prepared. The analyzed promoter region and the sequences of the corresponding primers used for PCR amplification and pyrosequencing analysis were listed in our previously published article [36 (link)].
10
CYP2C19 Genotyping and Omeprazole PK
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Testing was performed for CYP2C19 variants including the *2 (rs4244285), *3 (rs4986893), *4 (rs28399504), *8 (rs41291556), and *10 (rs6413438) alleles. Pyrosequencing (PSQ) genotyping assays were developed for these variant positions using the PyroMark Assay Design Software v2.0 (Qiagen Inc., Germantown, MD, USA). Primers selected for the PSQ assays were in‐silico screened for polymorphisms within the priming and sequencing regions of the genome using the UCSC browser21 and SNPcheck (Certus Technology Associates Limited and EMQN c/o Manchester Centre for Genomic Medicine). Genomic DNA amplification reactions were processed for the assay as described by the manufacturer in the Pyrosequencing Lab Instructions – MD and analyzed using the Pyrosequencer 96 MD instrument and software (Qiagen, Inc. Germantown, MD, USA).
The results of the CYP2C19 genetic polymorphism testing were used to evaluate the impact of CYP2C19 polymorphism on the PK of omeprazole and its metabolites. In addition, the magnitude of elagolix−omeprazole DDI was compared between the different subject subgroups based on CYP2C19 metabolizer status (extensive metabolizer “EM”, intermediate metabolizer “IM”, or poor metabolizer “PM”).
The results of the CYP2C19 genetic polymorphism testing were used to evaluate the impact of CYP2C19 polymorphism on the PK of omeprazole and its metabolites. In addition, the magnitude of elagolix−omeprazole DDI was compared between the different subject subgroups based on CYP2C19 metabolizer status (extensive metabolizer “EM”, intermediate metabolizer “IM”, or poor metabolizer “PM”).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!