The internal BamHI restriction site of the Agaricus meleagris pdh1 gene [7] (link) in the vector pCR Blunt II TOPO (Invitrogen) pdh1 was removed by site-directed mutagenesis following the DpnI-method [28] (link) using the overlapping mutagenesis primers AmFw/AmRev (Table S1 ). The PCR-product was purified from an agarose gel, digested with DpnI for 2 h at 37°C to degrade methylated template-DNA, and 5 µL of the PCR product were transformed into chemically competent E. coli NEB5α. The presence of the mutation was confirmed by sequencing. The pdh1 gene was then amplified using the primer pairs AmKpnIfw/AmXbaIrev and AmBamHIfw/AmNotIrev. The purified product was digested with the respective restriction endonucleases and ligated into the equally treated vectors pPICZB and pYES2/CT, respectively. The resulting plasmids pPICZB_AmPDH and pYES2/CT_AmPDH were transformed into chemically competent E. coli NEB5α (New England Biolabs), proliferated and stored at −20°C.
E coli neb5α
Manufactured by New England Biolabs
Sourced in United States, Germany
E. coli NEB5α is a chemically competent Escherichia coli bacterial strain. It is designed for high-efficiency transformation and plasmid DNA propagation.
Automatically generated - may contain errors
Lab products found in correlation
E coli bl21 de3, by New England Biolabs (3 mentions)
Escherichia coli dh5α, by New England Biolabs (2 mentions)
Dsm 20259, by Leibniz Institute DSMZ (2 mentions)
Pcr blunt 2 topo, by Thermo Fisher Scientific (1 mentions)
In fusion cloning kit, by Takara Bio (1 mentions)
M17 broth, by Thermo Fisher Scientific (1 mentions)
E coli rosetta 2 de3, by Merck Group (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Brain derived neurotrophic factor (bdnf), by Thermo Fisher Scientific (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
T4 ligase, by New England Biolabs (1 mentions)
Phusion polymerase, by New England Biolabs (1 mentions)
In fusion hd, by Takara Bio (1 mentions)
Pet30a, by Merck Group (1 mentions)
Ndei and xhoi, by New England Biolabs (1 mentions)
Hek293t, by American Type Culture Collection (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
E coli xl1 blue, by Agilent Technologies (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
18 protocols using e coli neb5α
1
Removing BamHI Site from Agaricus meleagris pdh1 Gene
2
Transformation of E. coli with Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli NEB5α and Turbo high efficiency, chemically competent cells were purchased from New England Biolabs. Plasmid pGATA25 (link) positive selection vector was obtained from Purebiotech LLC and pRG1.0 was constructed as outlined below.
3
Generation of HSPB6 Deletion Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The previously described small ubiquitin modifier (SUMO)-fusion of HSPB6 [28] (link) was used as a template for the generation of the different deletion constructs and point mutants. All 10 amino acid N-terminal deletions (Fig. 2A ) were generated using whole plasmid amplification, where one primer contained an extension of sequence complementary to the other (Table S1 ). Point mutations were created using Quickchange mutagenesis. DpnI-treated PCR products were transformed into E. coli NEB5α (New England Biolabs) and positive clones were verified by sequencing. HSPB6 variants ΔN, ΔN11 and HSPB4 were created using the In-Fusion cloning kit (Clontech) into pETHSUL [29] (link). The template sequence for HSPB4 amplification was pANT7-cGST. HSPB4 obtained from the DNASU plasmid repository [30] (link). The full-length HSPB1 expression construct was described previously [28] (link). All constructs were designed such that, upon cleavage of the linearly fused SUMO chimera with recombinant SUMO-hydrolase, no additional non-native residues would be present on the target protein.
4
Lactococcus lactis Cloning and Transformation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All bacterial strains, phages and plasmids used in this study are listed in Supplementary Table S1 . L. lactis MG1363 and its derivative were grown at 30 °C in M17 broth (Oxoid) supplemented with 0.5% (w/v) glucose monohydrate (GM17). For solid media, 1.0% (w/v) agar was added to GM17 broth. L. lactis MG1363 were transformed by electroporation using a glycine-based protocol [20 (link)]. To maintain cloning plasmid vectors, chloramphenicol and/or erythromycin were added to a final concentration of 5 μg/mL each (Cm5 or Em5). For cloning purposes, chemically competent E. coli NEB5α were purchased (New England Biolabs, Whitby, ON, Canada) and transformed according to the manufacturer’s instructions. E. coli transformants were grown in BHI medium supplemented with 150 µg/mL erythromycin (Em150) and incubated at 37 °C with agitation. For solid media, 1.5% (w/v) agar was added to BHI Em150 broth.
5
Bacterial Cloning and Protein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
While no experimental model organism was used in the study, we used commercially available E. coli strains for cloning procedures and recombinant protein production. E. coli NEB5α (New England BioLabs) was used for cloning procedures. E. coli BL21 (DE3) (New England BioLabs) and E. coli Rosetta2 (DE3) (Sigma-Aldrich) were used for the recombinant protein production.
6
Cultivating Diverse Bacterial Strains
7
Cultivating Diverse Bacterial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Streptococcus salivarius subsp. thermophilus DSM 20259 (synonym S. thermophilus) was obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany). L. plantarum WCFS1, isolated from human saliva as described by Kleerebezem et al. [21 (link)], was originally obtained from NIZO Food Research (Ede, The Netherlands) and maintained in the culture collection of the Norwegian University of Life Sciences, Ås, Norway. Escherichia coli DH5α (New England Biolabs, Frankfurt am Main, Germany) was used in the transformation experiments involving the subcloning of DNA fragments. S. thermophilus and L. plantarum were cultivated in M-17 broth and in MRS media, respectively, at 37°C without agitation. E. coli NEB5α (New England Biolabs, Frankfurt am Main, Germany) was grown at 37°C in Luria–Bertani (LB) medium with shaking at 120 rpm. When needed, erythromycin was supplemented to media in concentrations of 5 μg/mL for Lactobacillus or 200 μg/mL for E. coli, whereas ampicillin was used at 100 μg/mL for E. coli.
8
Cloning and Transduction in S. aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Unless otherwise stated, all vectors were constructed in E. coli NEB5α (New England Biolabs, Ipswich, MA, United States) following previously described methods (Gibson et al., 2009 (link); Lund et al., 2018 (link)) before passage through S. aureus RN4220 for DNA methylation (Novick and Morse, 1967 (link)). Finally, constructs were transduced into S. aureus SH1000 using phage Φ11. Transductions and transformations were confirmed by PCR. The genomic DNA of SH1000 was used as a template for S. aureus gene amplification. Genomic DNA was isolated by incubating S. aureus cells in 2.5 μg/ml lysostaphin prior to extraction using a Qiagen DNeasy Blood & Tissue Kit (Cat no. 69506) in accordance with the manufacturer's instructions. S. aureus transposon mutants were obtained from the NARSA library (Bae et al., 2008 (link); Fey et al., 2013 (link)). Transposons were transduced from the library to the recipient strain and confirmed by PCR.
9
Recombinant Protein Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were purchased from Sigma-Aldrich (Merck) with highest possible purity, unless otherwise noted. Commercial BDNF was recombinantly expressed in E. coli and purchased from PeproTech. Lipids were from Avanti Polar Lipids. E. coli Rosetta2 (DE3) was used for the preparation of the S12 extract. E. coli NEB5α (New England Biolabs) was used for general molecular cloning purposes. E. coli BL21(DE3) (New England Biolabs) was used for recombinant protein expression.
10
Heterologous Expression of Furanoic Acid Decarboxylases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The P. thermopropionicum 2,5-furandicarboxylic acid decarboxylase (HmfF) gene (WP_012031668),
and G. kaustophilus HmfF gene (WP_011229502)
were codon optimized for E. coli and
synthesized (Genscript). The G. kaustophilus HmfF gene was synthesized with NdeI and XhoI restriction sites upstream and downstream of the coding
region, respectively. The gene was excised from the pUC57 plasmid
using NdeI and XhoI (NEB) and purified
using a QIAquick gel extraction kit (Qiagen). The insert was ligated
in to NdeI/XhoI linearized pET30a
(MerckMillipore) using T4 ligase (NEB).
The P.
thermopropionicum HmfF gene was amplified using Phusion
polymerase (NEB) and the primers Ptherm30aF (AAGGAGATATACATATGTCCCACTCCCTGCG)
and Ptherm30aR (GGTGGTGGTGCTCGAGTTCCAGGTAGTCTGCCAG)
(Eurofins), and the PCR product was cloned into pET30a (MerckMillipore)
linearized with NdeI and XhoI (NEB)
using Infusion HD (Clontech) and transformed into E.
coli NEB5α(NEB). The plasmid was transformed
into E. coli BL21(DE3) (NEB) either
on its own or cotransformed with ubiXpET21b as described previously.11 (link)
and G. kaustophilus HmfF gene (WP_011229502)
were codon optimized for E. coli and
synthesized (Genscript). The G. kaustophilus HmfF gene was synthesized with NdeI and XhoI restriction sites upstream and downstream of the coding
region, respectively. The gene was excised from the pUC57 plasmid
using NdeI and XhoI (NEB) and purified
using a QIAquick gel extraction kit (Qiagen). The insert was ligated
in to NdeI/XhoI linearized pET30a
(MerckMillipore) using T4 ligase (NEB).
The P.
thermopropionicum HmfF gene was amplified using Phusion
polymerase (NEB) and the primers Ptherm30aF (AAGGAGATATACATATGTCCCACTCCCTGCG)
and Ptherm30aR (GGTGGTGGTGCTCGAGTTCCAGGTAGTCTGCCAG)
(Eurofins), and the PCR product was cloned into pET30a (MerckMillipore)
linearized with NdeI and XhoI (NEB)
using Infusion HD (Clontech) and transformed into E.
coli NEB5α(NEB). The plasmid was transformed
into E. coli BL21(DE3) (NEB) either
on its own or cotransformed with ubiXpET21b as described previously.11 (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!