Primerscript 2 1st strand cdna synthesis kit

Total RNA was extracted from various rice tissues using the RNeasy Plant Mini Kit (Qiagen, MD, USA) and treated with RNase-Free DNase (Qiagen). First-strand cDNA was synthesized using a PrimerScript II 1st Strand cDNA Synthesis Kit (Takara, CA, USA) with an oligo(dT) 18 primer according to the manufacture’s protocol. The qRT-PCR amplification was performed using SYBR® Premix Ex Taq^TM II (Takara) with Roche LightCycler® 96 System (CT, USA) following the manufacturer’s instruction. The qRT-PCR amplification was performed with three biological replicates, and the rice Actin1 gene (LOC_Os03g50885) was used as an internal control for gene expression^{37 (link)}.

MTB strains (OD600 0.25) at mid-log phase were collected. Total RNA was extracted with TRIzol-Reagent (Invitrogen). Briefly, cell pellet was resuspended in 1 ml Trizol reagent, mixed with 400 ml 0.1 mm Zirconia Beads (Sigma Products) and lysed in a mini-bead beater (Biospec) for three cycles (40 s at maximal speed) with cooling on ice for 1 min between pulses. RNA was extracted according to the protocol of TRIzol-Reagent. The extracted RNA was further followed by DNase I treatment to eliminate DNA contamination. cDNA was synthesized using the PrimerScript II 1st strand cDNA synthesis kit (TaKaRa). Target gene transcript levels were measured by real-time PCR using SYBRH Premix Ex Taq GC (TaKaRa) on applied biosystems 7500 real-time PCR: 95 °C 60 s, 40 cycles of 95 °C 5 s, 62 °C 8 s and 72 °C 20 s, followed by melting curve analysis. The relative transcriptional level was determined by the 2^−ΔΔCt method. Reference strain H₃₇Rv (wild-type Rv0074) was as a control. The reference gene was 16S rRNA.

Fusarium oxysporum f. sp. cubense Snyder et Hensen (Foc 4) was purchased from Guangdong Microbiology Culture Center (Guangzhou, China). Potato Dextrose Agar medium(OXOID, UK) was used to cultivate the strain, and the mycelia were collected for total RNA extraction. Total RNA was extracted from the mycelia after 7-day culture by using Hipure Fungal RNA Mini Kit (Magen, China) according to the manufacturer’s instructions. First strand cDNA was reversely transcribed by using Primerscript® II 1^st strand cDNA synthesis Kit (Takara, Japan).
The coding sequence of FoPT1 was amplified by using N-terminal and C-terminal primers: 5′-ATGACACAAACAAAACACCTTCAAACG-3′ (FoPT1-F) and 5′-TGTACTTTCGGGTTCTCGAAATGCT-3′ (FoPT1-R).

Total RNA was extracted from AZ-521 cells using ISOGEN II (NIPPON GENE, Tokyo, Japan) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from 5 μg of total RNA using Primer Script II 1st strand cDNA Synthesis Kit (TaKaRa Bio, Shiga, Japan). Primers used for Bcl-xL amplification were 5′-gaattcgccaccatgtctcagagcaac;cgggagct-3′ and 5′-gtcgactttccgactgaagagtgagcccagcagaa-3′. cDNA was amplified in 25 μl of PrimeSTAR Max mixture according to the manufacturer’s protocol (TaKaRa Bio). The PCR conditions were as follows: 35 cycles of 98 °C for 10 s, 55 °C for 15 s and 72 °C for 60 s. To add 3’ adenine-overhangs, ExTaq polymerase (0.5 μl, TaKaRa Bio) was incubated with the reaction mixture at 72 °C for 10 min. PCR products were subjected to electrophoresis on 1% agarose gels containing ethidium bromide, and the band was extracted with a FastGene Gel/PCR Extraction Kit (Nippon Genetics Co. Ltd., Tokyo, Japan), subcloned into pMD20-T vector (TaKaRa Bio) and then inserted in the cloning sites (EcoR1 and Sal1) of pFLAG-CMV-5a vector (Sigma Aldrich). Cells were cultured in a 24-well plate (1×10⁵ cells per well) overnight and transfected with 0.5 μg of plasmids using X-tremeGENE HP DNA Transfection Reagent (Roche). After a 24-h incubation, cells were treated with the toxins for 10 h.

Induction of 3T3-L1 differentiation was performed as previously described. Cells were washed with PBS and lysed with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA was purified according to the manufacturer’s instructions. Total RNA was then reverse transcribed using the PrimerScript II 1st strand cDNA Synthesis Kit (TaKaRa, Kusatsu, Japan) with random hexamer primers according to the manufacturer’s protocols. Quantitative PCR was performed with a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA USA) using Power SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). The primers used for quantitative PCR were as follows: perilipin 1 forward, GGGACCTGTGAGTGCTTCC; perilipin 1 reverse, GTATTGAAGAGCCGGGATCTTTT; PPARγ forward, CCATTCTGGCCCACCAAC; PPARγ reverse, AATGCGAGTGGTCTTCCATCA; C/EBPα forward, CAAGAACAGCAACGAGTACCG; C/EBPα reverse, GTCACTGGTCAACTCCAGCAC; actin forward, GGCTGTATTCCCCTCCATCG; actin reverse, CCAGTTGGTAACAATGCCATGT.

For gene expression analyses, 12-day-old seedlings without cotyledons were collected and stored at −80 °C until use. Tissues were ground into fine powder in liquid nitrogen using a homogenizer. Total RNA was extracted using TRIzol (Ambion) and digested with RNase-free DNase (TaKaRa) according to the manufacturer’s protocol. Digested RNA was quantified, then reverse transcribed (RT) was done with a PrimerScript II 1st Strand cDNA Synthesis Kit (TaKaRa). Oligo-dT primer and miRNA-specific primers were used for preparing the first-strand cDNA of mRNA and miRNA, respectively. Real-time PCR was performed using diluted cDNA on Step One Plus (ABI) real-time PCR machine. TUBLIN2 and AtSnoR101 were served as the internal controls for mRNAs and miRNAs analyses, respectively. All qRT-PCR primers are listed in Supplementary Table.

3T3-L1 cells were seeded in the density of 1.6 x 10⁴ cells per 24-well plate. Induction of 3T3-L1 differentiation was performed as above. Cells were washed with PBS and lysed with TRIzol reagent (Life technologies). Total RNA was purified according to the manufacturer’s protocol. Total RNA (0.5 μg) was then reverse transcribed using the PrimerScript II 1st strand cDNA Synthesis Kit (TaKaRa, Kyoto, Japan) with random hexamer primers according to the manufacturer’s protocols. Quantitative PCR was performed with a CFX96 Touch realtime PCR detection system (Bio-Rad, CA, USA) using iTaq Universal SYBR Green Supermix (Bio-Rad, CA, USA). Primers used for quantitative PCR are listed in S1 Table.