Total RNA was extracted from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A total of 0.5 μg of RNA samples were reverse-transcribed using the PrimeScript RT-PCR kit (Transgen Biotech, Beijing, China). Gene specific primers were shown in Table 1
Sybr premix ex taq 2
Manufactured by Transgene
Sourced in China
SYBR Premix Ex Taq II is a ready-to-use solution for real-time PCR amplification and detection. It contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and buffer components. The solution is designed to perform efficient and sensitive real-time PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Doxorubicin, by Merck Group (1 mentions)
P erk1 2, by Cell Signaling Technology (1 mentions)
Pierce enhanced chemiluminescence ecl western blot substrate, by Thermo Fisher Scientific (1 mentions)
Sirna constructs, by RiboBio (1 mentions)
Gapdh, by Cell Signaling Technology (1 mentions)
Erk1 2, by Cell Signaling Technology (1 mentions)
Reactive oxygen species assay kit, by Beyotime (1 mentions)
Mitochondrial membrane potential assay kit, by Beyotime (1 mentions)
Anti inos, by Bioss Antibodies (1 mentions)
Anti mmp 9, by Bioss Antibodies (1 mentions)
Anti cox 2, by Bioss Antibodies (1 mentions)
Anti mmp1, by Bioss Antibodies (1 mentions)
Anti mmp3, by Bioss Antibodies (1 mentions)
Anti p p38, by Bioss Antibodies (1 mentions)
Anti p erk1 2, by Bioss Antibodies (1 mentions)
Gapdh, by Abcam (1 mentions)
Real time pcr system, by Bio-Rad (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
6 protocols using sybr premix ex taq 2
1
Gene Expression Analysis via RT-PCR
2
Investigating Anticancer Effects of DiOHF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DiOHF was purchased from Indofine Chemical Company (Hillsborough, USA). Doxorubicin was obtained from Sigma (St Louis, MO, USA). Reactive Oxygen Species assay kit and mitochondrial membrane potential assay kit were obtained from Beyotime Biotechnology (Shanghai, China). Primary antibodies against cleaved-caspase-3, Bid, and Bcl-2 were obtained from Abclonal (Wuhan, China), and ERK1/2, p-ERK1/2, and GAPDH were obtained from Cell Signaling Technology (Beverly, MA, USA). The Pierce enhanced chemiluminescence (ECL) western blot substrate and BCA™ protein assay kit were purchased from Thermo Scientific (Rockford, USA). TRIzol reagent was procured from Invitrogen (Carlsbad, CA, USA). The PrimeScript reverse transcription (RT)-polymerase chain reaction (PCR) kit and SYBR Premix Ex Taq II were obtained from TransGen Biotech (Beijing, China). The primers were procured from Tianyihuiyuan (Guangzhou, China), and the siRNA constructs were obtained from RiboBio (Guangzhou, China).
3
Quantifying Glioma circRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from glioma tissues and cells using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. Reverted First Strand cDNA Synthesis (TransGen, China) was applied to synthesize cDNA from RNA. qRT-PCR was performed using SYBR Premix Ex Taq II (TransGen, China) in an ABI 7500 PCR instrument. U6 served as the control to standardize circRNA expression. Primers were purchased from GenePharma.
4
Investigating Inflammatory Pathways in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IL-1β was obtained from T&L Biotechnology Co., LTD. (Beijing, China). DMEM medium and FBS were obtained from Genetime Biotechnology Co., Ltd. (Shanghai, China). Primescript™ reverse transcription kit and SYBR® Premix Ex Taq™ II were purchased from TransGen Biotech (Beijing, China). Antibodies including anti-MMP-1, anti-MMP-3, anti-MMP-9, anti-ADAMS-4, anti-ADAMS-5, anti-collagen, anti-aggrecan, anti-iNOS, anti-COX-2, anti-p-p38, anti-p-ERK1/2, and anti-p-p65 were all obtained from Bioss Biotechnology Co., Ltd. (Beijing, China). GAPDH was purchased from Abcam Inc. (Cambridge, U.K.). The sequences of primers used in the present study was obtained from Tsingke (Beijing, China). ELISA kits were purchased from MSKBIO Technology Ltd. (Wuhan, China).
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells using the Trizol reagent (Life Technologies, Carlsbad, CA, USA) and transcribed into complementary DNA (cDNA) using a first-strand cDNA synthesis kit. Quantitation of the mRNA level by qRT-PCR was performed on a real-time PCR system (Bio-Rad, Richmond, CA, USA) using SYBR Premix Ex Taq II (TransGen Biotech, Beijing, China). β-actin were served as internal controls in pigs and mouse. Supplementary Table S1 lists all primer sequences of this study. The formula “2−ΔΔCt” was used to calculate the mean of the triplicate cycle thresholds (CT) to obtain the relative gene expression level values.
6
Quantification of Phytohormone Pathway Genes in Tomato Aphid Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed to quantify the expression profile of the key genes associated with JA, SA, and ET pathways. The feeding of tomato aphid on plants treated with protein elicitors was considered a treatment, and plants treated with buffer were considered controls. For amplification of RT-qPCR, 12 gene primer pairs (Table 1 ) were used with the Applied Biosystems, USA (ABI 7500) system. All reactions were performed using the SYBR Premix Ex Taq II kit (TransGen Biotech, Beijing, China), in a 20 μL total sample volume (2.0 μL cDNA, 10.0 μL SYBR Premix Ex Taq II, 1.8 μL of primers, and 6.2 μL of distilled deionised water). The qRT-PCR procedure was as follows: pre-denaturation at 95 °C for 10 min, denaturation at 95 °C for 15 s, and annealing at 60 °C for 15 s, with a total of 40 cycles. Standard curves were run simultaneously PCR are shown in Table 1 .
Primer pairs used in the study.
| SOLYC04g079730 | GCAATCGGCGATTCTGCTAC | AATGGACTTCGATCCGATGA |
| SOLYC02g085730 | TCCGACTTGACATGCATGAT | TCCGATGGTACAGCATTAGC |
| SOLYC09g007900 | CTCATTGCAATGCATCGAGC | GCATTCTGAGGCGATTCAGC |
| SOLYC03g036480 | ACTCGAGCATCCGTAATCTG | GCGGATCGAAGGCGATCAT |
| SOLYC12g099000 | GCGTGCAGGTCGATCGATT | TCGAGGATCGACGTGTCATC |
| SOLYC03g043890 | CAGTGACCGTGATCGACAG | ATCCGTTAATGCAGCTACTA |
| Actin | ATCCGGTGACGTAACGTGTC | GCTAACGTACTGCAACGTAC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!