Neon electroporation buffer r

Two separate CRISPR guide RNA sequences (crRNA#1: 5′-CCGGGGCCGAGGGAAGGGCC(CGG)-3′ and crRNA#2: 5′- TGGGGGCCATCAGGGGGTCC(AGG)-3′) targeting the exon1 of ID3 open reading frame were designed using IDT Alt-R® CRISPR-Cas9 guide RNA design tool and were ordered as Alt-R® CRISPR-Cas9 crRNA (IDT technologies). 22 pmol crRNA was annealed with 22 pmol Alt-R^® CRISPR-Cas9 tracrRNA (IDT technologies) by heating at 95°C for 5 min and cooling down to room temperature. 18 pmol Alt-R® Cas9 nuclease was added to the annealed crRNA:tracrRNA complex and incubated for 15 min at room temperature (final volume = 1 μl). 200 000 cells were resuspended in 10 μl neon electroporation Buffer R (Thermo Scientific). The Cas9:crRNA:tracrRNA complex was added to the cells along with 1 μl of 25 μM electroporation enhancer (IDT technologies). Cells were electroporated using 10 μl Neon electroporation tips with the following settings: 1050 V, 30 ms, 2 pulses. Cells were transferred to 12-well plates containing 1 ml growth media. Seventy-two hours post-electroporation, single cells were sorted into 96-well plates and allowed to proliferate. Single-cell clones thus obtained were screened for ID3 knockout using immunoblotting and Sanger sequencing.