Power sybr green rna to ct 1 step kit

RNA was extracted using TRIReagent® chloroform extraction, according to manufacturer's instructions (Sigma). RNA concentration and purity were obtained by UV spectroscopy (Nanodrop 2000, Fisher). For snap frozen 3D constructs, TRIReagent® extraction was augmented by mechanical disruption of hydrogels via addition of metal beads in round bottomed Eppendorf's (Starlab, UK) in a TissueLyser II (Qiagen, UK) for 5 min at 20 Hz. Following disruption, beads were removed, and RNA was isolated as for monolayer samples.
All primers (Table 1) were validated for 5 ng of RNA per 10 μL real time‐polymerase chain reaction (RT‐PCR) reaction. RT‐PCR amplifications were carried out using Power SYBR Green RNA‐to‐CT 1 step kit (Qiagen, UK) on a 384 well ViiA Real‐Time PCR System (Applied Bio‐systems, Life Technologies), and analysed using ViiA 7RUO Software. RT‐PCR procedure was: 50 °C, 10 min (for cDNA synthesis), 95 °C, 5 min (reverse transcriptase inactivation), followed by 40 cycles of 95 °C, 10 s (denaturation), 60 °C, 30 s (annealing/extension). Melt analysis was then carried out using standard ViiA protocol. Relative gene expressions were calculated using the comparative CT (^ΔΔCT) method giving normalised expression ratios (Schmittgen & Livak, 2008). RPIIβ was the designated housekeeping gene in all RT‐PCR assays and no sample controls for each primer set were included on every plate.

Total RNA was isolated using RNeasy Mini Kit (50) (Qiagen #74104) following the supplier’s instructions and analyzed by qRT-PCR using the Power SYBR Green RNA-to-CT™ 1-Step kit (Cat. #4389986, Applied Biosystems) and the StepOnePlus Real-Time PCR System (Cat. #4376600, Applied BioSystems) according to the supplier’s instructions. Raw qRT-PCR data were processed with the StepOne software v2.1 (Applied Biosystems) using Gapdh as intersample normalization control. Primers used for transcript quantitation are 5′-GTTTCAGAGATGCGGAGAACC-3′ (forward for mouse Cdh1), 5′-CAGGCCGTCTTTGCCATTG-3′ (reverse for mouse Cdh1); 5′-TGC ACC ACC AAC TGC TTA GC-3′ (forward for Gapdh) and 5′-TCT TCT GGG TGG CAG TGA TG-3′ (reverse for Gapdh).

Real-time RT-PCR was performed as described previously (Dong et al., 2004 (link), 2005 (link)). Briefly, total RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA), and real-time RT-PCR was performed using Power SYBR Green RNA-to-CT 1-Step kit. Data were normalized to an internal control gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The sequences of primers for the PCRs were 5-CATGGCAACTCCAGAGCAG (forward) and GCTCCTTAAACTCATCCACC (reverse) for Ku70; AGAAGAAGGCCAGCTTTGAG (forward) and AGCTGTGACAGAACTTCCAG (reverse) for Ku80; CCGGACGGACCTACTACGACT (forward) and AGAACGACCTGGGCATCCT (reverse) for DNA-PKcs.