3130 dna sequencer, by Thermo Fisher Scientific - Product details

1

Standardization of Chinook Salmon Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

The same standardization methods developed by the GAPS group (Seeb et al. 2007) were employed to standardize amplification, electrophoresis, allele nomenclature and scoring methods achieved between HMSC and the Abernathy Fish Technology Center (AFTC) laboratories. Briefly, this exercise involved sharing and evaluating three independent and coded 96‐well plates containing Chinook salmon DNA samples:

Bin‐definition plate 1 was passed from HMSC to AFTC along with genotype data. AFTC amplified and analyzed these samples in their laboratory using an ABI 3130 DNA Sequencer to enable AFTC allele bin calibration and scoring with HMSC allele nomenclature.

Test plate 1/bin‐definition plate 2 was passed from HMSC to AFTC but without any genotype data. AFTC analyzed these samples and reported results back HMSC to assess standardization.

Test plate 2/bin‐definition plate 3 was passed from HMSC to AFSC without genotype data. AFTC analyzed these samples and reported results to HMSC for final assessment of standardization among laboratories.

Banks M.A., Jacobson D.P., Meusnier I., Greig C.A., Rashbrook V.K., Ardren W.R., Smith C.T., Bernier‐Latmani J., Van Sickle J, & O'Malley K.G. (2014). Testing advances in molecular discrimination among Chinook salmon life histories: evidence from a blind test. Animal Genetics, 45(3), 412-420.

+ Open protocol

+ Expand

2

Extraction and Analysis of N-Glycans from Pichia pastoris

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 4

Twelve Pichia pastoris strains and the Man5-Blast strain were started in a 24-well plate containing 2 ml YPD and grown overnight at 28° C. while shaking (250 rpm). After growth, cells were harvested by centrifugation (3000 g for 5 min at room temperature) and cell wall mannoproteins were extracted according to the protocol by Jacobs et al. (see Jacobs et al., 2009, Nature Protocols 4(1):58-70). The extracted mannoproteins (in 100 μl ddH20) were diluted to 300 μl with RCM buffer (8 M urea, 3.2 mM EDTA, 360 mM Tris-HCL, PH 8.6). N-glycans were prepared from these samples following the 96-well on-membrane deglycosylation procedure as published by Laroy et al. (Laroy et al., 2006, Nature Protocols, 1: 397-405).

After labeling the dried N-glycans with 8-aminopyrene-1,3,6-trisulphonic acid2, the excess of label was removed using size exclusion chromatography (Sephadex G-10 resin2). The samples were finally reconstituted in 10 μl of ultrapure water and diluted 10× prior to their injection (80″ at 1.2 kV) in the capillaries (e.l. 36 cm; i.d. 50 μm) of an ABI 3130 DNA sequencer. The following settings were applied: Oven temperature: 60° C. Run voltage: 15 kV; Prerun voltage: 180″ Run time: 1000″; Prerun time: 15 kV. The Genemapper v3.7 was used to analyze the obtained data and structures were assigned to the peaks (see FIG. 10).

US10612033B2. Pichia pastoris strains for producing predominantly homogeneous glycan structure (2020-04-07). Research Corporation Technologies, Inc. [US]. Inventors: Kurt R. Gehlsen [US], Thomas G. Chappell [US].

+ Open protocol

+ Expand

3

Extracting N-glycans from Pichia pastoris

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 4

Twelve Pichia pastoris strains and the Man5-Blast strain were started in a 24-well plate containing 2 ml YPD and grown overnight at 28° C. while shaking (250 rpm). After growth, cells were harvested by centrifugation (3000 g for 5 min at room temperature) and cell wall mannoproteins were extracted according to the protocol by Jacobs et al. (see Jacobs et al., 2009, Nature Protocols 4(1):58-70). The extracted mannoproteins (in 100 μl ddH20) were diluted to 300 μl with RCM buffer (8 M urea, 3.2 mM EDTA, 360 mM Tris-HCL, PH 8.6). N-glycans were prepared from these samples following the 96-well on-membrane deglycosylation procedure as published by Laroy et al. (Laroy et al., 2006, Nature Protocols, 1: 397-405).

After labeling the dried N-glycans with 8-aminopyrene-1,3,6-trisulphonic acid2, the excess of label was removed using size exclusion chromatography (Sephadex G-10 resin2). The samples were finally reconstituted in 10 μl of ultrapure water and diluted 10× prior to their injection (80″ at 1.2 kV) in the capillaries (e.l. 36 cm; i.d. 50 μm) of an ABI 3130 DNA sequencer. The following settings were applied: Oven temperature: 60° C. Run voltage: 15 kV; Prerun. voltage: 180″ Run time: 1000″; Prerun time: 15 kV. The Genemapper v3.7 was used to analyze the obtained data and structures were assigned to the peaks (see FIG. 10).

US10329572B2. Pichia pastoris strains for producing predominantly homogeneous glycan structure (2019-06-25). Research Corporation Technologies, Inc. [US]. Inventors: Kurt R. Gehlsen [US], Thomas G. Chappell [US].

+ Open protocol

+ Expand

4

Genetic Variant Analysis of ADAR1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers were designed to amplify the coding exons of
ADAR1 (Supplementary Table S1, online-only). Purified polymerase chain
reaction (PCR) amplification products were sequenced using BigDye terminator
chemistry and an ABI 3130 DNA sequencer. Mutation description is based on the
reference cDNA sequence NM_001111.4, with nucleotide numbering beginning from
the first A in the initiating ATG codon. Variants were assessed using the in
silico programs SIFT (http://sift.jcvi.org) and
Polyphen2 (http://genetics.bwh.harvard.edu/pph2/), and population allele
frequencies obtained from the ExAC (http://exac.broadinstitute.org) and gnomAD (http://gnomad.broadinstitute.org) databases.

Rice G.I., Kitabayashi N., Barth M., Briggs T.A., Burton A.C., Carpanelli M.L., Cerisola A.M., Colson C., Dale R.C., Danti F.R., Darin N., De Azua B., De Giorgis V., De Goede C.G., Desguerre I., De Laet C., Eslahi A., Fahey M.C., Fallon P., Fay A., Fazzi E., Gorman M.P., Gowrinathan N.R., Hully M., Kurian M.A., Leboucq N., Lin J.P., Lines M.A., Mar S.S., Maroofian R., Martí-Sanchez L., McCullagh G., Mojarrad M., Narayanan V., Orcesi S., Ortigoza-Escobar J.D., Pérez-Dueñas B., Petit F., Ramsey K.M., Rasmussen M., Rivier F., Rodríguez-Pombo P., Roubertie A., Stödberg T.I., Toosi M.B., Toutain A., Uettwiller F., Ulrick N., Vanderver A., Waldman A., Livingston J.H, & Crow Y.J. (2017). Genetic, Phenotypic, and Interferon Biomarker Status in ADAR1-Related Neurological Disease. Neuropediatrics, 48(3), 166-184.

+ Open protocol

+ Expand

5

Genetic Variant Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was obtained from peripheral blood using a standard salting out method. PCR reactions for the amplification of the SBF1 (GGC)-repeat were set up with the following primers:

Forward: TCTGGACCAATGGAGATGCG

Reverse: GAAGTAGTCCGCGAGCCG

PCR reactions were carried out in a final volume of 20 µl, at a final concentration of 30% high-GC buffer, in a thermocycler (Peqlab-PEQStar) under the following conditions: initial denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 45 s, annealing at 55 °C for 45 s, and extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. All samples included in this study were sequenced by the forward primer, using an ABI 3130 DNA sequencer (Suppl. 1).

Khamse S., Alizadeh S., Bernhart S.H., Afshar H., Delbari A, & Ohadi M. (2022). A (GCC) repeat in SBF1 reveals a novel biological phenomenon in human and links to late onset neurocognitive disorder. Scientific Reports, 12, 15480.

+ Open protocol

+ Expand

6

Extraction and Analysis of Pichia pastoris Mannoproteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 4

Twelve Pichia pastoris strains and the Man5-Blast strain were started in a 24-well plate containing 2 ml YPD and grown overnight at 28° C. while shaking (250 rpm). After growth, cells were harvested by centrifugation (3000 g for 5 min at room temperature) and cell wall mannoproteins were extracted according to the protocol by Jacobs et al. (see Jacobs et al., 2009, Nature Protocols 4(1):58-70). The extracted mannoproteins (in 100 μl ddH20) were diluted to 300 μl with RCM buffer (8 M urea, 3.2 mM EDTA, 360 mM Tris-HCL, PH 8.6). N-glycans were prepared from these samples following the 96-well on-membrane deglycosylation procedure as published by Laroy et al. (Laroy et al., 2006, Nature Protocols, 1: 397-405).

After labeling the dried N-glycans with 8-aminopyrene-1,3,6-trisulphonic acid2, the excess of label was removed using size exclusion chromatography (Sephadex G-10 resin2). The samples were finally reconstituted in 10 μl of ultrapure water and diluted 10× prior to their injection (80″ at 1.2 kV) in the capillaries (e.l. 36 cm; i.d. 50 μm) of an ABI 3130 DNA sequencer. The following settings were applied: Oven temperature: 60° C. Run voltage: 15 kV; Prerun voltage: 180″ Run time: 1000″; Prerun time: 15 kV. The Genemapper v3.7 was used to analyze the obtained data and structures were assigned to the peaks (see FIG. 10).

US11866715B2. Pichia pastoris strains for producing predominantly homogeneous glycan structure (2024-01-09). Research Corporation Technologies, Inc. [US]. Inventors: Kurt R. Gehlsen [US], Thomas G. Chappell [US].

+ Open protocol

+ Expand

7

IFIH1 Coding Exon Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers were designed to amplify the coding exons of IFIH1 (Supplementary Table 7). Purified PCR amplification products were sequenced using BigDye™ terminator chemistry and an ABI 3130 DNA sequencer. Mutation description is based on the reference cDNA sequence NM_022168.2, with nucleotide numbering beginning from the first A in the initiating ATG codon.

Rice G.I., del Toro Duany Y., Jenkinson E.M., Forte G.M., Anderson B.H., Ariaudo G., Bader-Meunier B., Baildam E.M., Battini R., Beresford M.W., Casarano M., Chouchane M., Cimaz R., Collins A.E., Cordeiro N.J., Dale R.C., Davidson J.E., De Waele L., Desguerre I., Faivre L., Fazzi E., Isidor B., Lagae L., Latchman A.R., Lebon P., Li C., Livingston J.H., Lourenço C.M., Mancardi M.M., Masurel-Paulet A., McInnes I.B., Menezes M.P., Mignot C., O’Sullivan J., Orcesi S., Picco P.P., Riva E., Robinson R.A., Rodriguez D., Salvatici E., Scott C., Szybowska M., Tolmie J.L., Vanderver A., Vanhulle C., Vieira J.P., Webb K., Whitney R.N., Williams S.G., Wolfe L.A., Zuberi S.M., Hur S, & Crow Y.J. (2014). Gain-of-function mutations in IFIH1 cause a spectrum of human disease phenotypes associated with upregulated type I interferon signaling. Nature genetics, 46(5), 503-509.

+ Open protocol

+ Expand

8

RASGEF1C Repeat Amplification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was obtained from peripheral blood using a standard salting out method. PCR reactions for the amplification of the RASGEF1C (GGC)-repeat were set up with the following primers.
Forward: GAGGGTGAACTGGGTTTTGG.
Reverse: ACTCTAGCGGCTGAAAGAAG.
PCR reactions were carried out with a GC-TEMPase 2 × master mix (Amplicon) in a thermocycler (Peqlab-PEQStar) under the following conditions: touchdown PCR: 95 °C for 5 min, 20 cycles of denaturation at 95 °C for 45 s, annealing for 45 s at 67 °C (− 0.5 decrease for each cycle) and extension at 72 °C for 1 min, and 30 cycles of denaturation at 95 °C for 40 s, annealing at 57 °C for 45 s and extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. Genotyping of every sample included in this study was performed following Sanger sequencing by the forward primer, using an ABI 3130 DNA sequencer (Supplementary Information 1 and 2).

Jafarian Z., Khamse S., Afshar H., Khorshid H.R., Delbari A, & Ohadi M. (2021). Natural selection at the RASGEF1C (GGC) repeat in human and divergent genotypes in late-onset neurocognitive disorder. Scientific Reports, 11, 19235.

+ Open protocol

+ Expand

9

IFIH1 Coding Exon Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers were designed to amplify the coding exons of IFIH1 (Supplementary Table 7). Purified PCR amplification products were sequenced using BigDye™ terminator chemistry and an ABI 3130 DNA sequencer. Mutation description is based on the reference cDNA sequence NM_022168.2, with nucleotide numbering beginning from the first A in the initiating ATG codon.

Rice G.I., del Toro Duany Y., Jenkinson E.M., Forte G.M., Anderson B.H., Ariaudo G., Bader-Meunier B., Baildam E.M., Battini R., Beresford M.W., Casarano M., Chouchane M., Cimaz R., Collins A.E., Cordeiro N.J., Dale R.C., Davidson J.E., De Waele L., Desguerre I., Faivre L., Fazzi E., Isidor B., Lagae L., Latchman A.R., Lebon P., Li C., Livingston J.H., Lourenço C.M., Mancardi M.M., Masurel-Paulet A., McInnes I.B., Menezes M.P., Mignot C., O’Sullivan J., Orcesi S., Picco P.P., Riva E., Robinson R.A., Rodriguez D., Salvatici E., Scott C., Szybowska M., Tolmie J.L., Vanderver A., Vanhulle C., Vieira J.P., Webb K., Whitney R.N., Williams S.G., Wolfe L.A., Zuberi S.M., Hur S, & Crow Y.J. (2014). Gain-of-function mutations in IFIH1 cause a spectrum of human disease phenotypes associated with upregulated type I interferon signaling. Nature genetics, 46(5), 503-509.

+ Open protocol

+ Expand

10

Sequencing and Phylogenetic Analysis of CprM Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

The amplicon generated by RT-PCR was visualized by SyBr safe nucleic stain (Thermo Fisher Scientific, Waltham, MA, USA). The samples harbouring 511 bp target amplicon were then gel extracted using Quaquick Gel extraction kit (Qiagen, Hilden, Germany). DNA sequencing from both ends of the CprM gene was conducted on an ABI 3130 DNA sequencer (ABI) using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (ABI) as previously described (Deval et al., 2021 (link)).
The alignment of partial CprM sequences from this study and references sequences retrieved from GenBank (GB) was performed using the ClustalW. The alignment of partial CprM sequences generated from this study and references sequences retrieved from GenBank (GB) was performed using the ClustalW platform. The aligned sequences were trimmed manually to obtain the consensus sequence. The phylogenetic tree was constructed through Molecular Evolutionary Genetics Analysis (MEGA) software version X. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The reliability of the tree was estimated using 1,000 bootstrap replications under the Nearest-Neighbour interchange procedure with input distance determined by the Maximum-Likelihood method (Kumar et al., 2018 (link)).

Behera S.P., Bhardwaj P., Deval H., Srivastava N., Singh R., Misra B.R., Agrawal A., Kavathekar A, & Kant R. (2023). Co-circulation of all the four Dengue virus serotypes during 2018–2019: first report from Eastern Uttar Pradesh, India. PeerJ, 11, e14504.

+ Open protocol

+ Expand

3130 dna sequencer

Lab products found in correlation

22 protocols using 3130 dna sequencer

Standardization of Chinook Salmon Genotyping

Extraction and Analysis of N-Glycans from Pichia pastoris

Extracting N-glycans from Pichia pastoris

Genetic Variant Analysis of ADAR1

Genetic Variant Amplification and Sequencing

Extraction and Analysis of Pichia pastoris Mannoproteins

IFIH1 Coding Exon Sequencing

RASGEF1C Repeat Amplification Protocol

IFIH1 Coding Exon Sequencing

Sequencing and Phylogenetic Analysis of CprM Gene

About PubCompare

Ready to get started?