Rotor gene q 2plex real time pcr system

Total RNA was isolated and extracted from 30 Drosophila larvae CNS, whole body, or carcass using TRIzol^® Reagent (Life Technologies, Carlsbad, CA) and purified using the RNeasy kit (Qiagen, Valencia, CA). First-strand cDNA was synthesized from poly(A) RNA using the SuperScript^® III First-Strand Synthesis System for real-time quantitative PCR (qRT-PCR) (Life Technologies) according to manufacturer instructions. qRT-PCR was then performed on an Qiagen Rotor Gene Q 2Plex Real-Time PCR System using the operating instructions. Relative quantification was carried out using the 2-^DDCT method^{30 (link)}, and beta-actin was used as the reference gene. Appropriate controls, such as DNAse and removal of reverse transcriptase, were performed to ensure the sample was not contaminated with genomic DNA. The CNS dissection included as many descending neurons as possible and the carcass was comprised of just the body wall muscle and associated neurons. All primers used in this study were purchased from Life Technologies with primer reference numbers for the irk1, irk2, irk3 and actin genes being Dm02143600_s1, Dm02143725_g1, Dm01796588_g1, and Dm02361909_s1, respectively. Five biological replicates were conducted and each was analyzed in triplicate. The graphed output displays average fold-change in mRNA levels relative to the wildtype Oregon-R control CNS.

The total viral RNA was extracted from the samples using QIAamp Viral RNA extraction Kit (Qiagen, United States) following the manufacturer’s instructions. Specific primers (forward; 5’-AGTGATGTGCTCGGACCTTC-3′ & reverse; 5’-CCTGAGGAGAGGCATTTGCTA-3′) and probe (5′-[FAM]TTCTCTAGCAGTGGGACAGCCTGC[TAMRA]-3′) amplifying and detecting a highly conserved sequence within NDV M gene viral RNAs (Wise et al., 2004 (link)) using the Qiagen one-step RT-PCR Kit. The RT-PCR thermal profile included an initial RT step at 50°C for 30 min followed by 15 min treatment at 95°C. The PCR cycling profile consisted of 40 cycles of (i) denaturation at 94°C for 10 s, (ii) annealing at 52°C for 30 s, and (iv) extension at 72°C for 10 s, with a final extension step at 72°C for 10 min. The quantification of the extracted RNAs was carried out on the Rotor Gene Q 2plex Real Time Pcr System (Qiagen, United States).

qRT-PCR was performed to determine the expression of EsVATB in different tissues and molting stages. qRT-PCR was conducted using SYBR Green Premix Ex Taq (Takara, Dalian, China) in a Rotor-Gene Q 2PLEX real-time PCR system (Qiagen, Germany). The total reaction mixture included 6.25 µl SYBR Green Premix Ex Taq, 0.25 µl of each sense and antisense primer (10 µM), 1 µl cDNA, and 4.25 µl ddH₂O. The standard curve was first obtained using fivefold dilutions of the cDNA for EsVATB and the specific gene primer. The ubiquitin/ribosomal S27 fusion protein gene served as an internal reference gene (Huang et al., 2017 (link)). Three biological replicates and three technical replicates were obtained for the qRT-PCR. The expression results were presented as the means±standard error calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). The expression of EsVATB was measured in the G tissue and InM stage as internal calibration control in different tissues and molting stage experiments, respectively.