Lenticas9 blast

Manufactured by Addgene

Sourced in United States

LentiCas9-Blast is a lentiviral vector that expresses the Cas9 endonuclease from Streptococcus pyogenes and a blasticidin resistance marker. It is designed for the delivery and expression of Cas9 in target cells.

Automatically generated - may contain errors

Lab products found in correlation

Lentiguide puro, by Addgene (73 mentions) Pspax2, by Addgene (18 mentions) Pmd2 g, by Addgene (16 mentions) Blasticidin, by Thermo Fisher Scientific (14 mentions) Polybrene, by Merck Group (10 mentions) Lenticrispr v2, by Addgene (10 mentions) Puromycin, by Merck Group (10 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (10 mentions) Blasticidin, by Merck Group (9 mentions) Blasticidin, by InvivoGen (9 mentions) Pcmv vsv g, by Addgene (8 mentions) Lentiguide puro vector, by Addgene (8 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (7 mentions) Roswell park memorial institute (rpmi), by Thermo Fisher Scientific (6 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (6 mentions) Puromycin, by Thermo Fisher Scientific (6 mentions) Lenti dcas9 krab blast, by Addgene (5 mentions) T4 dna ligase, by New England Biolabs (5 mentions) Pxpr 011, by Addgene (5 mentions) Rpmi 1640, by Thermo Fisher Scientific (5 mentions)

239 protocols using lenticas9 blast

Constructing Expression Vectors for DPF3 and SNIP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vector encoding human DPF3a and DPF3b were constructed by replacing the Cas9 cassette on lentiCas9-Blast (Addgene) with the HA-tagged DPF3a/DPF3b coding sequence followed by T2A and mCherry cassettes. The expression vector encoding human SNIP1 was constructed by replacing the Cas9 cassette on lentiCas9-puro (Addgene) with a Flag-tagged SNIP1 coding sequence by T2A and GFP cassettes. The shRNAs targeting SNIP1 were cloned into the PLKO.1-puro vector (Addgene). The lenti-Luciferase plasmid was constructed by replacing the Cas9 cassette on lentiCas9-puro or lentiCas9-Blast (Addgene) with a luciferase cassette. Bacterial expression vectors for DPF3a and SNIP1 were constructed by subcloning the cDNA sequences into the pGEX-6P-1 vector.

Cui H., Yi H., Bao H., Tan Y., Tian C., Shi X., Gan D., Zhang B., Liang W., Chen R., Zhu Q., Fang L., Gao X., Huang H., Tian R., Sperling S.R., Hu Y, & Chen W. (2022). The SWI/SNF chromatin remodeling factor DPF3 regulates metastasis of ccRCC by modulating TGF-β signaling. Nature Communications, 13, 4680.

+ Open protocol

+ Expand

CRISPR Knockout of TP53 and BCL-2 in Lymphoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Z-138 and OCI-LY19 cells were transduced with lentiCas9-Blast from Addgene (Cambridge, MA). 48 h after transduction cells were selected using 10 and 12 μg/ml blasticidin, respectively, for 5 days. Puromycin resistance cassette from LentiGuide-Puro vector backbone (Addgene 52963) was swapped for GFP and the following guide RNA sequences: TP53 KO1: 5′-GATCCACTCACAGTTTCCAT-3′; TP53 KO2: 5′-GAGCGCTGCTCAGATAGCGA-3′; BCL-2 KO: 5′-GGCCTTCTTTGAGTTCGGTG-3′ were cloned into it. Z-138 and OCI-LY19 cells were transduced with lentiviral sgRNAs particles and 3 days post-transduction GFP-positive cells were sorted. Successful knockout was confirmed by immunoblotting.

Erazo T., Evans C.M., Zakheim D., Chu K.L., Refermat A.Y., Asgari Z., Yang X., Da Silva Ferreira M., Mehta S., Russo M.V., Knezevic A., Zhang X.P., Chen Z., Fennell M., Garippa R., Seshan V., de Stanchina E., Barbash O., Batlevi C.L., Leslie C.S., Melnick A.M., Younes A, & Kharas M.G. (2022). TP53 mutations and RNA-binding protein MUSASHI-2 drive resistance to PRMT5-targeted therapy in B-cell lymphoma. Nature Communications, 13, 5676.

+ Open protocol

+ Expand

Lentiviral CRISPR/Cas9 Genome Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCas9-Blast (Addgene #52962) was co-transfected with pCMV-VSV-G and psPAX2 into HEK293T cells for lentivirus production using TransIT-293 (MIR2700, Mirus Bio). Virus in the media was collected 48 hours after transfection and MOC1-esc1 cells were transduced for 48 hours and then subjected to Blasticidin (4 μg/ml) selection for 4 days. Pooled MOC1-esc1-cas9 cells were single cell sorted in 96-well cell culture plate to generate single clones. Cas9 editing efficiency of each clone was tested by the assessing the knock out efficiency of B2M sgRNA expressing lentivirus transduced cells. H2-K^b class I cell surface expression levels were determined by flow cytometry as a readout of Cas9 efficiency (not shown). Clone #2 and #3 with high editing efficiency were transduced with lentivirus expressing specific gRNAs targeting EZH2 or ROSA26, respectively. The sequences of specific sgRNAs are listed below.
EZH2-g1-oligo1: CACCGTATCGTAGTAAGTACCAATG
EZH2-g1-oligo2: AAACCATTGGTACTTACTACGATAC
EZH2-g2-oligo1: CACCGAGAGTACATTATAGGCACCG
EZH2-g2-oligo2: AAACCGGTGCCTATAATGTACTCTC
ROSA26-oligo1: CACCGCAATCAGCGGAGGCTGCCG
ROSA26-oligo2: AAACCGGCAGCCTCCGCTGATTGC

Zhou L., Mudianto T., Ma X., Riley R, & Uppaluri R. (2019). Targeting EZH2 enhances antigen presentation, antitumor immunity and circumvents anti-PD-1 resistance in head and neck cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 26(1), 290-300.

+ Open protocol

+ Expand

Lentiviral CRISPR Genome Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCas9-Blast (Addgene #52962) or Lenti-dCAS9-VP46-Blast (Addgene #61425) and lenti-MS2-p65-HSF1-Hygro (Addgene #61426) were used to generate stable cell lines for gene knockout and activation, respectively. We used the GeCKO A pooled sgRNA library (Addgene #1000000049) and the SAM pooled sgRNA library (Addgene #1000000057) for gene knockout and activation screening. We used lentiSAMv2 (Addgene #75112) for single gene activation validation. Guides were cloned as described previously [20 (link)]. pMD2.G (Addgene #12259) and psPAX2 (Addgene # 12260) were used to facilitate viral packaging of sgRNA pools and single vector plasmids.

Ramaker R.C., Hardigan A.A., Gordon E.R., Wright C.A., Myers R.M, & Cooper S.J. (2021). Pooled CRISPR screening in pancreatic cancer cells implicates co-repressor complexes as a cause of multiple drug resistance via regulation of epithelial-to-mesenchymal transition. BMC Cancer, 21, 632.

+ Open protocol

+ Expand

Comparative Cell Line Analysis with ER Stress Inducers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The A549, HEK-293, and HEK-293T cell lines were purchased from the American Type Culture Collection (Rockville, MD). The A549 cells were cultured in RPMI (Gibco, Life Technologies, Grand Island, NY), and HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% FBS (Gibco) and penicillin and streptomycin (Gibco) in a humidified incubator with 5% CO₂. Cells were kept in culture for no more than 6 months after resuscitation from the original stocks. The A549 and HEK-293 Cas9-expressing cells were generated via lentiviral transduction using virus produced from the lentiCas9-Blast (Addgene, 52962), psPAX2 packaging, and pMD2.GVG envelope plasmids. Tunicamycin (Tn; 1 μM) and NGI-1 (10 μM) were used to inhibit N-linked glycosylation in cell culture, and dimethyl sulfoxide treatment was used as a vehicle control. Thapsigargin (100 nM; Selleckchem, Houston, TX) was used to induce ER stress. The proteasome and protease inhibitors, bortezomib (BZM; 100 nM, Selleckchem) and E64 (10 μM, Selleckchem), were used to inhibit cellular proteolytic activity. EGFR and IGF-1R activity was assessed by treatment with either EGF (R&D Systems, Minneapolis, MN) or IGF-1 (R&D Systems) ligands, respectively.

Phoomak C., Cui W., Hayman T.J., Yu S.H., Zhao P., Wells L., Steet R, & Contessa J.N. (2021). The translocon-associated protein (TRAP) complex regulates quality control of N-linked glycosylation during ER stress. Science Advances, 7(3), eabc6364.

+ Open protocol

+ Expand

Engineered 293 Cell Lines with Cas9 and SP1-MHI

Check if the same lab product or an alternative is used in the 5 most similar protocols

We made two cell lines from 293 cells, one that expressed Cas9 (lentiCas9-blast, Addgene #52962), referred to as 293WT+Cas9, and another that expressed both Cas9 and SP1-MHI, referred to as 293WT+Cas9+SP1. These cell lines were made by transfecting the plasmids with lipofectamine as described above and selecting stably transfected cells using Blasticidin selection for Cas9 and Neomycin selection for SP1-MHI.

Rafnsdottir S., Jang K., Halldorsdottir S.T., Tomasdottir A., Vinod M., Möller K., Reynisdottir T., Atladottir L.H., Allison K.E., He J., Zhang L., Northington F.J., Chavez-Valdez R., Anderson K.J, & Bjornsson H.T. (2023). SMYD5 is a novel epigenetic gatekeeper of the mild hypothermia response. bioRxiv.

+ Open protocol

+ Expand

CRISPR Knockout and Deletion of Pitx1 and Klf4 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Pitx1 binding domain was deleted with, two sgRNAs targeting the 5ánd 3ŕegion of the sequence. For Klf4 CRISPR knock-outs, we designed single sgRNAs targeting its first exon. Klf4 enhancer deletion was performed with two sgRNAs flanking Pitx1 and Klf4 bound regions (Figure S9A). The most efficient guide RNAs were predicted using the CRISPR design tool MIT (Zhang Lab, MIT 2015). sgRNA against dTomato was used as a control. sgRNA sequences were cloned into pLKO U6-puro or GFP-modified vector (Addgene 52963). After sgRNA transduction, cells subsequently infected with lentiCas9-Blast (Addgene 52962), and selected with Blasticidin for 3 days (5μg/ml). For Pitx1 gene knockout, single clones were selected and screened by PCR on cDNA libraries. Clones were further validated by Western blot analysis with anti-PITX1 antibodies. Klf4 gene editing was performed in a pooled format and tumor cells were tested by Western blotting with anti-KLF4 antibodies. For Klf4 enhancer deletions, gDNA was extracted and screened by PCR. sgRNA sequences are listed in Table S7.

Sastre-Perona A., Hoang-Phou S., Leitner M.C., Okuniewska M., Meehan S, & Schober M. (2019). De novo PITX1 expression controls bi-stable transcriptional circuits to govern self-renewal and differentiation in squamous cell carcinoma. Cell stem cell, 24(3), 390-404.e8.

+ Open protocol

+ Expand

Generating NF1-targeting Lentiviral Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

LIM1215 cells were transduced with Cas9 viral particles (a gift from Feifei Song, Stephen Pettitt and Chris Lord, derived from lentiCas9-Blast (Addgene # 52962, a gift from Feng Zhang)) in the presence of Polybrene (8 μg/mL) and selected with 5 μg/mL Blasticidin to create constitutively expressing Cas9 lines, confirmed by Western blotting using Cas9 (7A9-3A3) antibody (Cell Signalling Technologies #14697). To produce lentiviral guide RNAs targeting NF1, HEK293T cells were transfected with pLentiguide-NF1#1 and pLentiguide-NF1#2 (a gift from Stephen Pettitt and Chris Lord, customized from pLentiguide-Puro (Addgene #52963, a gift from Feng Zhang)) in combination with packaging plasmids psPAX and pMD2.G. LIM1215-Cas9 cells were transduced with the resultant viral gRNA supernatants in the presence of Polybrene (8 μg/mL).

Woolston A., Khan K., Spain G., Barber L.J., Griffiths B., Gonzalez-Exposito R., Hornsteiner L., Punta M., Patil Y., Newey A., Mansukhani S., Davies M.N., Furness A., Sclafani F., Peckitt C., Jiménez M., Kouvelakis K., Ranftl R., Begum R., Rana I., Thomas J., Bryant A., Quezada S., Wotherspoon A., Khan N., Fotiadis N., Marafioti T., Powles T., Lise S., Calvo F., Guettler S., von Loga K., Rao S., Watkins D., Starling N., Chau I., Sadanandam A., Cunningham D, & Gerlinger M. (2019). Genomic and Transcriptomic Determinants of Therapy Resistance and Immune Landscape Evolution during Anti-EGFR Treatment in Colorectal Cancer. Cancer Cell, 36(1), 35-50.e9.

+ Open protocol

+ Expand

Generating CRISPR β-catenin knockout cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate the backbone plasmid for the CRISPR/Cas9 system, the lentiGuide-Puro (Addgene #52963) was modified by inserting a KpnI site in front of the U6 promoter and replacing the HindIII site behind the sgRNA scaffold with an EcoRI site, named as LG-U6. The LG-H1 plasmid was also produced by replacing the U6 promoter with the H1 promoter in the LG-U6 plasmid. The LG-U6 and LG-H1 plasmid for expressing sgRNAs targeting intron 2 and intron 3 of β-catenin (sgRNA-in2 and sgRNA-in3) were constructed following the manufacture’s manual (Supplementary Table 4). The H1-sgRNA-in3 sequence was tandemly cloned into the EcoRI site of the LG-U6-sgRNA-in2 plasmid (Fig. 1a). The HuH7 and 3H3 cells were sequentially infected with the lentiviral vectors for constitutively expressing SpCas9 (lentiCas9-Blast; Addgene #52962) and simultaneously expressing sgRNA-in2 and sgRNA-in3, and then treated with 10 μg/mL blasticidin and 10 μg/mL puromycin, respectively. The subclones with β-catenin alleles lacking exon 3 were isolated by limiting dilution.

Akasu M., Shimada S., Kabashima A., Akiyama Y., Shimokawa M., Akahoshi K., Kudo A., Yamaoka S., Tanabe M, & Tanaka S. (2021). Intrinsic activation of β-catenin signaling by CRISPR/Cas9-mediated exon skipping contributes to immune evasion in hepatocellular carcinoma. Scientific Reports, 11, 16732.

+ Open protocol

+ Expand

Lenti-Cas9 Transduction and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

lentiCas9-Blast (Addgene plasmid ID 52962) or lentiCas9-Venus were produced as described above and used to transduce HUDEP-2 cells. Transduced cells were selected with 10 μg/mL blasticidin or Venus⁺ cells were sorted. Functional Cas9 was confirmed using the pXPR-011 (Addgene plasmid ID 59702) GFP reporter assay as previously described⁶⁰.

Canver M.C., Smith E.C., Sher F., Pinello L., Sanjana N.E., Shalem O., Chen D.D., Schupp P.G., Vinjamur D.S., Garcia S.P., Luc S., Kurita R., Nakamura Y., Fujiwara Y., Maeda T., Yuan G.C., Feng Z., Orkin S.H, & Bauer D.E. (2015). BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature, 527(7577), 192-197.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!